1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marusya05 [52]
3 years ago
6

The immune system is the body's defense against disease. White blood cells, or lymphocytes, are one type of immune system cell.

Which of the following immune system cells make markers that tag invading pathogens for later destruction?
a.helper T cells
b.cytotoxic T cells
c.macrophages
d.B cells
Biology
1 answer:
Novosadov [1.4K]3 years ago
6 0

b) cuz(my instinct says so)

You might be interested in
What system includes oceans, lakes, rivers, and groundwater? a. geosphere b. hydrosphere c. atmosphere d. biosphere Please selec
kirill [66]
Hydrosphere is the correct answer my man.

6 0
2 years ago
Read 2 more answers
The diploid cells that begin spermatogenesis are called spermatogonia. Where are spermatogonia found?
Salsk061 [2.6K]
Spermatogonia are found in testes.
4 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
2 years ago
Read 2 more answers
I REALLY NEED HELP. I DO NOT GET THIS AT ALL. PLEASE HELP ME. IT WILL BE GREATLY APPRECIATED.
kati45 [8]

Answer:

The test cross is shown below

      T         T

t      Tt         Tt

t       Tt         Tt

The alleles shown in the vertical side (tt) are recessive and come from the male parent. The alleles TT are dominant and come from the female parent.

For the variety of offsprings to be 100% tall, the recessive parent had to be crossed with a homozygous dominant parent.  If the female was heterozygous with which the cross was done,then there would be small tomato plants in the offspring generation.

3 0
3 years ago
What cells in the body are most likely to have originated through the process of meiosis?
Sholpan [36]
Sexual reproduction cells. Or just sex cells
3 0
2 years ago
Other questions:
  • how is energy transferred from the sun's core to the sun's surface in the radiative zone and in the convective zone? I need the
    14·1 answer
  • If a spear is thrown at a fish swimming in a lake, it will often miss the fish completely. Why does this happen?
    13·1 answer
  • Which of the following shows an unsaturated fatty acid?
    13·2 answers
  • Which descriptions apply to Mendel’s pea plant experiments? Select three options.
    6·2 answers
  • Which type of stem cell can differentiate into the least number of types of cells?
    13·1 answer
  • In 2010, an area in the Gulf of Mexico was the site of the worst oil spill in United States history. The Deepwater Horizon oil r
    8·1 answer
  • A rock is dropped into 20 mL of water. It displaces 15 mL. The volume of the rock is
    8·1 answer
  • The father of two children is type 0+, and the mother is type A+. The children are O- and A+.
    13·1 answer
  • Dna is made of chains of four smaller molecules called.
    14·1 answer
  • How do the herbivores in a savanna habitat avoid competition?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!