Hmm...,
Well from what I'm getting, I feel like the cell would just be replication itself. Cell differentiation is the process by which a cell gets placed, or destined, to become a particular type of cell.
So, if a cell was to go undergo cell division with out cell differentiation, this most likely means it is going under the DNA replication process, AK.A- splitting the mother cell to create daughter cells.
Answer:
The gradualism model depicts evolution as a slow steady process in which organisms change and develop slowly over time. In contrast, the punctuated equilibrium model depicts evolution as long periods of no evolutionary change followed by rapid periods of change.
Explanation:
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
