1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AveGali [126]
3 years ago
8

Why is the top layer of the ocean the warmest?

Biology
2 answers:
KATRIN_1 [288]3 years ago
8 0

Answer:

Option (C)

Explanation:

The water at the top portion of the ocean is comparatively hotter than the lower portion. It is because of the absorption of sunlight as the sunlight is directly incident on its surface. This absorbed incoming heat energy increases the temperature of the water, as a result of which it becomes less denser than the bottom cold water. It is also because of this reason, the heat energy is transferred from the hydrosphere region to the atmosphere due to the continuous interaction between the ocean and the atmosphere.

Thus, the top layer of ocean is warmest because of the high absorption of heat, where the surface warmer water are less denser than the cold bottom water.

Hence, the correct answer is option (C).

MaRussiya [10]3 years ago
4 0

Answer:

Because the top layer is where all the sun hits and it causes the top of the ocean to be warmer because the water absorbs the light

Explanation:

You might be interested in
Bioethanol is an example of plants being used for what function?
Galina-37 [17]

The principle fuel used as a petrol substitute for road transport vehicles is bioethanol. Bioethanol fuel is mainly produced by the sugar fermentation process, although it can also be manufactured by the chemical process of reacting ethylene with steam.

Basically, a plant can be considered as bioethanol becacuse it is a sugar fuel for animals. Animals consume plants for fuel to survive.

6 0
3 years ago
A scientist is studying a new chemical he hopes will prevent insects from eating raspberry bushes. he sprays the chemical on a r
Law Incorporation [45]
What're the choices? :)
7 0
3 years ago
The scientific explanation that suggests the universe is expanding relies on two main concepts
laiz [17]
Doppler effect and redshift as the light coming from stars from the distance can be shifted in the same way as a pitch of sound does
4 0
3 years ago
The action of bacterial enzymes on fiber in the large intestine results in the _____.
Zanzabum

The correct answer is b. Release of short-chain fatty acids.

The intestinal microflora is complex ecosystem which contains over 400 bacterial species.That microflora is  capable of fermenting indigestible carbohydrates (dietary fiber) to short-chain fatty acids such as acetate, propionate, and butyrate.


4 0
3 years ago
rue or false: DNA replication in eukaryotes occurs unidirectionally from multiple origins of replication.
IrinaVladis [17]

Answer:

False

Explanation:

In eukaryotes, replication begins from multiple origins of replication and the replication forks move bidirectionally to replicate the DNA.

6 0
2 years ago
Other questions:
  • If a dog cell has 72 chromosomes how many chromosomes will be in each daughter cell
    13·1 answer
  • A metabolic bone disorder, particularly common in postmenopausal women, is called scoliosis.
    8·1 answer
  • All living things can be found in the biosphere atmosphere hydrosphere geosphere
    7·1 answer
  • Can someone help me with this question ?
    13·2 answers
  • The thoracic duct returns excess fluid, termed lymph, from below the thorax and the left side of the body to the ____________ ,
    10·1 answer
  • Which of the following processes begins when a star enters the main sequence?
    5·2 answers
  • At which latitude were these apparent Sun paths most likely observed?
    10·1 answer
  • Structure and Properties of Matter:Question 4
    15·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • What type of boundary is depicted in the image below?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!