1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
posledela
3 years ago
11

The ____________ (size/color) of crystals formed depends on the speed of evaporation.

Biology
1 answer:
ser-zykov [4K]3 years ago
6 0
Its the color of crystals formed depends on the speed of evaporation
You might be interested in
Why do beetles stay out more at night ?
Angelina_Jolie [31]
They Are probably more nocturnal <span />
8 0
3 years ago
Read 2 more answers
Which statement below is true of both chloroplasts and mitochondria?
MissTica

Answer:

Its either B or D but i think its B

Explanation:

i hope it B if not then its D

7 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Which dna mutations is most likely to damage the protein it specifies?
Radda [10]
<h2>DNA Mutations</h2>

Explanation:

<em>    (A) A base-pair deletion</em>

  • <em>Insertion or deletion brings about a frame shift that changes the perusing of consequent codons</em> and, hence, adjusts the whole amino acid arrangement that follows the transformation, additions and cancellations are normally more harmful than a substitution in which just <em>a solitary amino corrosive is modified </em>
  • DNA changes brought about by mutagens may hurt cells and cause certain illnesses,<em> for example, malignancy</em>
  • <em>Instances of mutagens incorporate radioactive substances, x-beams, bright radiation, and certain synthetic compounds</em>
6 0
4 years ago
What is recombination
Rufina [12.5K]

Answer:

Recombination is a process by which pieces of DNA are broken and recombined to produce new combinations of alleles. This recombination process creates genetic diversity at the level of genes that reflects differences in the DNA sequences of different organisms.

5 0
3 years ago
Other questions:
  • To decrease the risk of neural tube defects, women who are capable of becoming pregnant are urged to consume at least 400 microg
    15·1 answer
  • Which term describes the school of psychology that studies the reasons for behavior and how organisms adapt to environments?
    6·1 answer
  • A model of an atom is shown below. Which element does this atom represent?
    14·1 answer
  • Explain the relationship between limiting factors and population size​
    9·1 answer
  • The first line of defense involves which structures?
    10·2 answers
  • Need help fast please!!!
    8·1 answer
  • A substance that can be dissolved is a
    14·1 answer
  • 7. What is a layout of chromosomes in humans in order from largest to smallest with the
    7·1 answer
  • Which of the following examples most accurately describes Newton's first law of motion?
    5·1 answer
  • Question 3(Multiple Choice Worth 4 points)
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!