1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Georgia [21]
3 years ago
11

How many miles is it from Turtle Bay to Waialua Bay​

Mathematics
1 answer:
lidiya [134]3 years ago
4 0
12.9 miles or 27 minutes

You might be interested in
Can someone help me?
mestny [16]

Answer:

Step-by-step explanation:

To do this, we must use the unit circle. At the angle \frac{\pi }{6} the coordinate pair is (\frac{\sqrt{3} }{2}, \frac{1}{2}) and the hypotenuse is 1

Now that we know these we can start using the trig functions

sin = y

cos = x

tan = \frac{y}{x}

And the other functions would be the reciprocal of these

csc = \frac{1}{y}

sec = \frac{1}{x}

cot = \frac{x}{y}

This would mean that

sinx = \frac{1}{2}

cosx =\frac{\sqrt{3} }{2}

tanx =\frac{1}{\sqrt{3} } or \frac{\sqrt{3} }{3} if you're supposed to rationalize your denominators

cscx = 2

secx = \frac{2}{\sqrt{3} } or \frac{2\sqrt{3} }{3}

cot = \sqrt{3}

6 0
2 years ago
How to use the GCF and the distributive property of 40+ 50
iren2701 [21]
Hsndmf Nd didjsuduysysbsbsndndhyz
6 0
3 years ago
A family paid $26.400 as a down payment for a home. If this represents 16% of the price of the home, find the price of the home.
Vlada [557]
The correct answer is:

How to find X if P percent of it is Y. Use the percentage formula Y/P% = X

Convert the problem to an equation using the percentage formula: Y/P% = X
Y is 26,400, P% is 16%, so the equation is 26,400/16% = X
Convert the percentage to a decimal by dividing by 100.
Converting 16% to a decimal: 16/100 = 0.16
Substitute 0.16 for 16% in the equation: 26,400/0.16 = X
Do the math: 26,400/0.16 = X
X = 165,000
So $ 165,000 is the price of the home.

I hope this helps you!!
7 0
3 years ago
Question 3 Solve for m. 4 over 3 m equals 4
Lorico [155]

Answer:

m = 3

Step-by-step explanation:

\frac{4}{3} m = 4 \\ divide \: both \: sides \: by \:  \frac{4}{3}  \\  \\ m = 3

3 0
3 years ago
What is equal to 3 * 3 * 3 * 3 * 3​
ladessa [460]

Answer:

243 or 3^5

Step-by-step explanation:

You can do the product by multiplying starting from the left.

3 * 3 * 3 * 3 * 3​ =

= 9 * 3 * 3 * 3

= 27 * 3 * 3

= 81 * 3

= 243

You can also change it to an exponential form.

3 * 3 * 3 * 3 * 3​ = 3^5

3 0
3 years ago
Read 2 more answers
Other questions:
  • How to factor: 15x^2y^3 + 10xy^2z
    5·1 answer
  • Is 84/45 a irrational repeating decimal or just a irrational one
    14·1 answer
  • X= 3 - 61<br> What are the real and imaginary parts of : ?
    13·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Shown here is the graph of a function f.
    8·1 answer
  • Given the equation a/b=c/d , what is the value of d. Show your solution
    10·1 answer
  • Jessie installed 12 more axles than the number of engine blocks her friend Gus installed yesterday. Write an equation for g, the
    10·2 answers
  • A cone and a cylinder have congruent height and base bases. The volume of the cone is 18m squared. What's the volume of the cyli
    6·1 answer
  • PLEASE HELP WILL MARK BRAINLIEST
    6·2 answers
  • What are the difference and similarities between a quadratic function and its transformation?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!