1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
8

Which of the following is a characteristic of our sun

Biology
1 answer:
Allisa [31]3 years ago
5 0
<h2>Characteristics of our sun.</h2>

Explanation: Question is incomplete.

You might be interested in
What is the function of RBC
avanturin [10]

Answer:

When a red blood cell is placed in a hypertonic solution, it contracts as water is drawn out of the cell and into the surrounding solution. If the same blood cell is placed in a hypotonic solution, the blood cell grows in size. Blood cells in isotonic solutions do not shrink or swell.

The reason that blood cells change in size when placed in a solution with different salt concentration is due to the osmosis process. Osmosis causes solutions with high concentrations of salt to draw water from areas with low concentrations of salt.

There are some exceptions to this phenomenon. Blood cells can draw water and explode when placed in hypertonic solution on some special occasions. Some diseases affect the structural integrity of blood cells. Also, when human blood cells are exposed to temperatures close to freezing, they can draw water and explode.

Osmosis is an important phenomenon for living systems. The amount of salt in a given solution exhibits a tendency to diffuse through the environment, eventually resulting in equilibrium. In addition to blood cells, the kidneys function through the use of osmotic principles. The kidneys filter an animal's blood to remove excess salt and balance the amount of water

7 0
3 years ago
Read 2 more answers
During the rainy months in Africa, temporary pools of water form. One fish species, the snakehead fish, is able to walk, using p
Vaselesa [24]
<span>B) The snakehead fish will replace the other fish species.</span>
6 0
3 years ago
Read 2 more answers
What cell process is controlled by the nucleus?
lesya692 [45]
The cell process that is controlled by the nucleus is Protein Synthesis.
5 0
3 years ago
Read 2 more answers
what is one major function of the endomembrane system? producing and storing energy, transporting subtances in a cell, manufactu
astraxan [27]
Transporting substances in a cell. proteins are transported either in or out of the cell.
4 0
3 years ago
Read 2 more answers
To solve a problem, scientists follow a series of steps called?
Natalija [7]

Answer:

The scientific method

Explanation:

1. Observation

2. Ask a question

3. Form hypothesis

4. Make a prediction of hypothesis

5. Test Prediction

6. Iterate: make new hypothesis or problems with found results.

7 0
3 years ago
Other questions:
  • When your biceps brachii (upper arm) muscle contracts, ultimately and most directly, what is producing the movement?
    8·2 answers
  • An adolescent presents to a community clinic for treatment of vulvar lesions associated with type 2 herpes simplex. which interv
    11·1 answer
  • Approximately how much time passes between H and B?
    13·2 answers
  • During dna replication, two extra guanine bases are added to the dna. what type of mutation is this?
    9·2 answers
  • The spindle apparatus disintegrates during _____. anaphase telophase interphase metaphase
    8·2 answers
  • Which marine ecosystem has the fewest available nutrients and the lowest productivity? A) estuaries B) open ocean C) coral reefs
    11·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Why is a squid considered a cephalopod?
    8·2 answers
  • Protein markers react with specific ______, which are proteins found in the immune system.
    10·1 answer
  • Think of an object, person, or place at home that functions similar to the cell membrane.
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!