1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zlopas [31]
3 years ago
14

Which statement describes a property of both prokaryotic and eukaryotic cells

Biology
2 answers:
ad-work [718]3 years ago
4 0
What are the statements?

snow_lady [41]3 years ago
3 0
They are both a kind of cell? I don’t know what the choices are
You might be interested in
An organism's _______ describes its genetic composition. An organism's _______ describes its appearance or observable characteri
belka [17]

Answer:

Chem formation, DNA

Explanation:

This is because of how an organism is made up/gets its genes.

4 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Why is the cell the lowest level of biological organization the that can maintain life?
Leya [2.2K]

Answer:

It's the lowest level of biological organization that can survive and reproduce as long as appropriate conditions are achieved.

Explanation:

5 0
3 years ago
To the base pair given write the correct matching base pair for
adelina 88 [10]

AT, GC

Explanation:

Adenine (A) pairs with Thymine (T).

Guanine (G) pairs with Cytosine (C).

A - T

C - G

T - A

T - A

G - C

C - G

hope this helps you!

5 0
3 years ago
Why dont two species occupy the exact same ecologial niche?
frez [133]
Because they would need to compete over resources.
3 0
3 years ago
Other questions:
  • Describe the flow of water from the north Atlantic through the rest of the oceans
    12·1 answer
  • What are the three main body segments of insects? The choices are the following:. Head, mandible, thorax. Head, thorax, abdomen.
    15·2 answers
  • Which is not a role of the cystic fibrosis transmembrane conductance regulator (CFTR)? A Option A: conductor of bicarbonate ions
    6·1 answer
  • G Which of the following statements is false?
    15·1 answer
  • Which observation about the phosphorus tracer supported the researchers' conclusion that DNA, and not proteins, transmits geneti
    12·1 answer
  • a population of chimpanzees was separated when the forest that they lived in had a section cut down and a town was built. After
    11·2 answers
  • Offer two reasonable solutions to slow or deter drug resistance among insects and bacteria
    15·1 answer
  • In regulation by repression Multiple Choice an amino acid activates the repressor so that the repressor binds to the operator an
    14·1 answer
  • An ecosystem has many levels of organization. Which level will have the most individuals?
    7·1 answer
  • Which option would help maintain homeostasis during exercise?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!