1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eduardwww [97]
3 years ago
11

X-x/4-1/3=2+x/4 please answer me ​

Chemistry
1 answer:
Karo-lina-s [1.5K]3 years ago
7 0

Answer:

x= 14/3 = 4.667

Explanation:

X - X/4 - 1/3 = 2 + X/4

You might be interested in
Write the chemical formulas for the ionic compound vanadium (v) oxide
olya-2409 [2.1K]
V2O5 is the formula. Vanadium has a charge of +5 and oxygen is -2, so to make them equal, you need to double the vanadium charge and multiply the oxygen charge by 5
5 0
4 years ago
What carries electric current from the cell to the other components of a circuit.​
Rasek [7]

Answer:

The different objects that make up a circuit are called components. A circuit must have a power source, such as a battery, and the current flows through a conductor, such as a wire.

Explanation:

I hope that was useful.

3 0
3 years ago
Which reactant is unlikely to produce the indicated product upon strong heating?
Ilya [14]

2-Methyl-4-oxo-pentanoic acid  is unlikely to produce 2-Methyl-3-butanone upon strong heating.

Upon heating, the β ketoacid becomes unstable and decarboxylates, leading to the formation of the methyl ketone.

A carboxylic acid is an organic acid that contains a carboxyl group (C(=O)OH) attached to an R-group. The general formula of a carboxylic acid is R−COOH or R−CO2H, with R referring to the alkyl, alkenyl, aryl, or other group.

Carboxylic acids occur widely. Important examples include the amino acids and fatty acids. Deprotonation of a carboxylic acid gives a carboxylate anion.

Full question :

Q.  Which reactant is unlikely to produce the indicated product upon strong heating?

  • A) 2,2-Dimethylpropanedioic acid 2-methylpropanoic acid
  • B) 2-Ethylpropanedioic acid Butanoic acid
  • C) 2-Methyl-3-oxo-pentanoic acid 3-Pentanone
  • D) 2-Methyl-4-oxo-pentanoic acid 2-Methyl-3-butanone
  • E) 4-Methyl-3-oxo-heptanoic acid 3-Methyl-2-hexanone

Hence, option (D) is correct.

Learn more about carboxylic acid here : brainly.com/question/26855500

#SPJ4

8 0
2 years ago
Which label belongs in the area marked X? can reproduce by budding can reproduce by fragmentation with regeneration reproduce in
marusya05 [52]

Answer:

Nucleus.

Explanation:

The sponge is a multicellular organism that consists of pores that allows water to move through the body. Sponges belong to the kingdom Animalia and phylum Porifera. Sponges can reproduce by budding. Sponges are placed in kingdom Animalia because they are unable to make their own food, made of more than one cell, and absence of cell wall.

4 0
3 years ago
What happens to the gas particles in an an inflated ball when it gets a hole? why?
netineya [11]
The gas flows from higher concentration/pressure to lower concentration/pressure, which is outside the ball.
7 0
4 years ago
Read 2 more answers
Other questions:
  • What is another name for a column of elements
    8·2 answers
  • A chemist adds 405.0mL of a 0.79M sodium carbonate solution to a reaction flask. Calculate the millimoles of sodium carbonate th
    13·1 answer
  • Explain the roles of products, reactants, and limiting reactant in a chemical reaction.
    13·1 answer
  • Solid iodine trichloride is prepared in two steps: first, a reaction between solid iodine and gaseous chlorine to form solid iod
    8·1 answer
  • How do you determine the difference between a living specimen and a nonliving one?
    7·1 answer
  • Part a the disproportionation of mn2+(aq) to mn(s) and mno2(s) in acid solution at 25 ∘c. calculate δg∘rxn.
    11·1 answer
  • Is a 15 year old sophomore considered part of the labor force? Why or why not?
    8·1 answer
  • The force that holds paticles together in the atomic nuecleaus?
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • im sorry but um can someone go see if they can help me with my most recent question...if you don't know the answer its cool just
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!