1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
monitta
3 years ago
9

Which activity can occur without the use of

Biology
2 answers:
zysi [14]3 years ago
5 0
4 because osmosis does not require energy
Juli2301 [7.4K]3 years ago
5 0
<h3>movement of water across a membrane</h3>
You might be interested in
Which of these shows the level of complexity, from simplest to most complex?
Serga [27]
It is B organs- organ systems- organism
7 0
3 years ago
A friend asks for you help in learning the different cavities of the body. She is knows where the spine and abdominal cavity are
Dahasolnce [82]

Answer:

Explanation:

The thoracic cavity is the anterior ventral body cavity found within the rib cage in the torso. It houses the primary organs of the cardiovascular and respiratory systems, such as the heart and lungs, but also includes organs from other systems, such as the esophagus and the thymus gland.

4 0
3 years ago
Which organelles do eukaryotic cells have that prokaryotic cells do not have? this is a test hellpppp fast please name
Anestetic [448]

Answer:

Eukaryotic cells contain membrane-bound organelles, such as the nucleus, while prokaryotic cells do not.

8 0
3 years ago
Read 2 more answers
Living things should not be viewed under a(n) _____ because the preparation process would kill them.
FinnZ [79.3K]

Answer:

Electron Microscope

Explanation:

In contrast to light microscopes, electron microscopes use a beam of electrons instead of a beam of light. Not only does this allow for higher magnification and, thus, more detail, it also provides higher resolving power. The method used to prepare the specimen for viewing with an electron microscope kills the specimen. Electrons have short wavelengths (shorter than photons) that move best in a vacuum, so living cells cannot be viewed with an electron microscope.

8 0
3 years ago
Read 2 more answers
This macromolecule (large) is used to carry genetic information. It's building block is called a nucleotide.
MissTica

Explanation:

Nucleic acids are long chainlike molecules composed of a series of nearly identical building blocks called nucleotides. Each nucleotide consists of a nitrogen-containing aromatic base attached to a pentose (five-carbon) sugar, which is in turn attached to a phosphate group.

8 0
3 years ago
Other questions:
  • In the short-term response to hemorrhage, ________ occurs.
    7·1 answer
  • Which agency publishes the food code
    13·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Help please!<br><br>Where in the cell does transcription occur?
    10·2 answers
  • Please help.. I don't understand!!
    8·1 answer
  • Which characteristic is NOT common to all mammals?
    13·1 answer
  • Which organ grinds food into a semiliquid while adding acid, enzymes, and gastric juice?
    8·1 answer
  • an ice cube is set on a table at room temperature for 3 hours. what happens to the temperature of the ice cube and the table
    9·1 answer
  • You are a wild rabbit and your species currently lives in desert. Most of the rabbits are brown but there are a few that are whi
    15·1 answer
  • All vertebrate embryos have _____ at some point during embryonic development, indicating a common evolutionary ancestor
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!