Part 1:
A solution that causes a cell to swell is a hypotonic solution.
In an isotonic solution, there is no change in the size of the cell.
All three cause osmosis.
A solution that causes a cell to shrink is a hypertonic solution.
Part 2:
1. H. Energy
2.D. Endocytosis
3.G. Diffusion
4.B. Exocytosis
5.E. Facilitated Diffusion
6.A. Osmosis
7.C. Active Transport
8.F. Passive Transport
Sorry. I don't know how to explain part 3 ,but I tried and failed so I deleted it. Part 1 and 2 are correct though.
Answer:
endocrine
Explanation:
i got it right on the quiz thingy. hope u got it right cause there was a time limit. haha :)
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer:It is called The Foramen Magnum
Explanation: It is a large oval opening linking the Spinal cord and the Brain
Hope this helps : )
Restriction enzymes identifies specific sequences in the DNA (Deoxyribonucleic acid) and cut the DNA to produce fragments. These enzymes are used in the production of the recombinant DNA. These enzymes cut out the specific required fragment of the DNA, which is then incorporated into the bacteriophage. This recombinant phage DNA then infects the bacterial cell, which produces new particles with this foreign recombinant DNA.
