1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slega [8]
3 years ago
15

Four fishermen fished for the same amount of time in different ponds. Which catch most likely came from the pond with the highes

t level of dissolved oxygen?
A. Catch A
B. Catch B
C. Catch C
D. Catch D

Biology
1 answer:
irina [24]3 years ago
8 0

Correct Answer: B. Catch B  

Explanation: Fish depend on dissolved oxygen to survive. Ponds with high levels of dissolved oxygen will support more fish (and larger fish) than ponds with low levels of dissolved oxygen. Trout are particularly sensitive to dissolved oxygen levels, so a pond with a healthy trout population probably has high levels of dissolved oxygen.




Hope this helped pls like this and love this!1!!!1111!1!!!♥♥♥♥♥

You might be interested in
NEED HELP ASAP MARINE BIOLOGY
11111nata11111 [884]

Answer:

B is right

Explanation:

3 0
3 years ago
Read 2 more answers
Joe was observing an embryo with 16 cells. What is a 16-celled embryo called?
o-na [289]
A 16-called embryo is Called A Morula
6 0
3 years ago
Read 2 more answers
Identify the structures of the male reproductive system using the drop-down menus.
ICE Princess25 [194]
1. Testosterone
2. Penis
3. Testes
4. Semen
5. Scrotum
6. Vas Defrens
7. Seminal Vesicle
4 0
3 years ago
Read 2 more answers
Where does the urea in the urine come from?
Vesnalui [34]

Answer:

Urea is produced when foods containing protein, such as meat, poultry, and certain vegetables, are broken down in the body. Urea is carried in the bloodstream to the kidneys, where it is removed along with water and other wastes in the form of urine.

Explanation:

8 0
2 years ago
Read 2 more answers
When the fertilized egg implants somewhere outside the uterus, this is called a(n)?
Romashka [77]
When the fertilized egg implants somewhere outside the uterus is called ectopic pregnancy 
.
7 0
3 years ago
Other questions:
  • Conserving the quality of available water is a high priority world-wide. There are many countries whose water supply is reaching
    6·2 answers
  • Riparian foliage _______.
    9·2 answers
  • What are the correct charges for the hydrogen and oxygen atoms within a water molecule?
    5·1 answer
  • Would you be likely to find a food chain containing 10 links? Why or why not?
    10·1 answer
  • What type of kingdom does a plant go in
    11·1 answer
  • Mary determined that 5 pollen grains could fit along the diameter of the field of view of her microscope. If each pollen grain h
    15·1 answer
  • 3. Explain the role of organisms in the carbon<br>cycle and oxygen cycle ​
    8·1 answer
  • Help please
    6·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • What is the function of the genetic material in the cell​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!