1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jarptica [38.1K]
3 years ago
13

How do fungi differ from plants?!

Biology
2 answers:
mr Goodwill [35]3 years ago
4 0

Answer: A

Fungi are heterotrophic (decomposers) and are often mistaken as a plant because its rooted in the soil. But what also makes them different from plants is that fungi don't do photosynthesis and not all fungi are multicellular.

romanna [79]3 years ago
3 0

Answer:

The answer is A.

Explanation:

Hope this helped :)

You might be interested in
What effects result when there is an impact between Earth and an asteroid? Check all that apply.
icang [17]

Answer:

2,4,5 bud.

Explanation:

7 0
3 years ago
Read 2 more answers
What can radiometric dating reveal
Dahasolnce [82]
Radiometric dating reveals the exact (i think its exact) age of a fossil.
3 0
3 years ago
Read 2 more answers
a group of of scientists is studying the internal parts of a cell. which microscope is most appropraite for these scientist to u
kozerog [31]

An Electron microscope

4 0
3 years ago
An _____ is a scientist who might study of bones found in an old grave.
nikdorinn [45]
Archaeologist



hope it is correct
4 0
2 years ago
Read 2 more answers
What are facts about embryonic stem cell research?
Igoryamba
Derived from the inner cells of a human blastocysts , a very early human embryo.
At the blastocyst stage, five to 10 days after fertilization,
the embryo is a cluster of 100-200 cells
7 0
3 years ago
Read 2 more answers
Other questions:
  • What is the main difference between sulfate minerals and sulfide minerals?(17 points) plz help me :(
    15·1 answer
  • Describe how you produced summated contractions with the isolated muscles and how you produced a tetanus contraction. explain ho
    7·1 answer
  • A local wetland was recently paved over to make a new retail center and amusement park. The wetland was home to a rare species o
    11·1 answer
  • During an acute MI, there is ischemic damage to the heart muscle. The location and extent of the ischemic damage is the major pr
    9·1 answer
  • During proofreading, which of the following enzymes reads the DNA?
    9·1 answer
  • A child has been brought to the emergency department by child's grandparent. the grandparent tells the nurse, "it is important t
    7·1 answer
  • What are the offsprings ​
    8·2 answers
  • Need an answer, please thanks
    14·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Which of the following does not describe how a change in the structure of genes can affect the function of the organism?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!