1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SpyIntel [72]
4 years ago
11

What is a solution?

Chemistry
2 answers:
swat324 years ago
4 0
1. heterogeneous
2. suspension
3.collide
4.A homogeneous mixture
i think my number one is wrong but idk hope this help! 100%
Tom [10]4 years ago
4 0

1. Heterogeneous

2. Suspension

3. Collide

4. A homogeneous mixture



You might be interested in
Fission and fusion are alike in many ways. However, one difference is
Annette [7]

Explanation:

Fusion vs Fission

In fission, energy is gained by splitting apart heavy atoms, for example uranium, into smaller atoms such as iodine, caesium, strontium, xenon and barium, to name just a few. However, fusion is combining light atoms, for example two hydrogen isotopes, deuterium and tritium, to form the heavier helium. Both reactions release energy which, in a power plant, would be used to boil water to drive a steam generator, thus producing electricity.

4 0
3 years ago
How many grams of magnesium chloride can be produced from 2.30 moles of chlorine gas reacting w excess magnesium Mg(s)+Cl2(g)-&g
alexdok [17]

Answer:

<em>219 g</em>

Explanation:

6 0
3 years ago
Draw a Lewis structure for SO 2 in which all atoms obey the octet rule. Show formal charges. Do not consider ringed structures.
blagie [28]

Answer:

The answer is attached below

Explanation:

To draw the Lewis structure the sulphur willl be placed in the centre with the Valence electron sorrounding it the electrons between sulphu and oxygen to form bonds

5 0
3 years ago
Noble gas compounds like KrF, XeCl, and XeBr are used in excimer lasers. Draw an approximate molecular orbital diagram appropria
Aneli [31]

Answer:

Here's what I get.

Explanation:

The MO diagrams of KrBr, XeCl, and XeBr are shown below.

They are similar, except for the numbering of the valence shell orbitals.

Also, I have drawn the s and p orbitals at the same energy levels for both atoms in the compounds. That is obviously not the case.

However, the MO diagrams are approximately correct.

The ground state electron configuration of KrF is

(1\sigma_{g})^{2}\, (1\sigma_{u}^{*})^{2} \, (2\sigma_{g})^{2} \, (2\sigma_{u}^{*})^{2} \, (3\sigma_{g})^{2} \,  (1\pi_{u})^{4} \, (1\pi_{g}^{*})^{4} \, (3\sigma_{g}^{*})^{1}

KrF⁺ will have one less electron than KrF.

You remove the antibonding electron from the highest energy orbital, so the bond order increases.

The KrF bond will be stronger.

6 0
4 years ago
What is the empirical formula of Fe?
Lera25 [3.4K]

Answer:

The ratio is 1.000 mol of iron to 1.500 mol of oxygen (Fe1O1.5). Finally, multiply the ratio by two to get the smallest possible whole number subscripts while still maintaining the correct iron-to-oxygen ratio: The empirical formula is Fe2O3.

7 0
3 years ago
Read 2 more answers
Other questions:
  • What is the purpose of finding oxidation states in the half-reaction method for balancing equations?
    9·1 answer
  • Select the correct answer. _____enable long-term resistance to infections that have been present in the body before. A. Monocyte
    5·1 answer
  • What is HNO3 it's formula​
    7·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What is dalang puppeteer​
    6·1 answer
  • How is electronegativity used in determining the ionic or covalent character of the bonding between two elements?
    6·1 answer
  • What type of reaction does this equation represent?<br><br> 2I4O9(s) → 4I2(s) + 9O2(g)
    15·1 answer
  • The Brazos River is a major river in Texas. In many parts of the Cross Timbers and Prairies ecoregion, the river has formed tall
    12·1 answer
  • A beaker is filled to the 500 mL mark with alcohol. What increase in volume (in mL) does the beaker contain when the temperature
    13·1 answer
  • Is VAL ("23")+5=28? It is a true and false question.​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!