1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solong [7]
3 years ago
13

Where in the chloroplast is chlorophyll found?

Biology
1 answer:
Aleksandr-060686 [28]3 years ago
4 0

It's found in the thylakoid membrane.

You might be interested in
Why is algae classified in the Protist Kingdom and not the Plant Kingdom even though they are photosynthetic? Research why some
KengaRu [80]
Algae are photosynthetic, but they are also unicellular organisms (Euglena) and shares some of the common features with plants as well as animals. They move like animals and perform photosynthesis like plants. Therefore, they are classified into Protists, and not the Algae. Their most features resemble the non-photosynthetic protozoa, and not plants, and therefore, are put into the Protista. 
They also lack a cell wall, which is a feature of plants.
Some scientists advocate their classification in plants because of their sexual mode of reproductiona, and formation of spores.
8 0
3 years ago
Name 2 factors that determine how cold, warm, wet or dry the earth becomes
OLEGan [10]

Latitude or distance

4 0
3 years ago
What evidence could be used to convince policy makers to change a shipping lane from going through a whale breeding ground?
bekas [8.4K]

Answer:

B-Information on the number of all whales hit by boats in the given area

Explanation:

If they see that they have some responsibility in harming the whales, it may change their behavior.

5 0
3 years ago
The diagram shows the box for an element in the periodic table.
PolarNik [594]

Answer:

13

Explanation:

The atomic number for Aluminum (Al) is 13. If you have access to the periodic table, this would've taken a few seconds.

6 0
3 years ago
Which base is normally used in the synthesis (making) of RNA but not in the synthesis (making) of DNA?
fiasKO [112]

The correct answer is uracil.

<span>Uracil is one of the pyrimidine nucleotide bases which is the component of nucleic acid-RNA. In RNA, uracil binds to adenine via two hydrogen bonds (complementary binding). Uracil is not found in DNA, it is replaced by thymine because it is thymine’s demethylated form.</span>
8 0
3 years ago
Other questions:
  • What is ecology? Why does it matter?
    12·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The leader of the skirmish against Chitto Harjo and other resistance leaders was US Marshal __________
    5·1 answer
  • Describe the role of each 3 of RNA<br>​
    11·1 answer
  • How many nuclei will be left after the second half-life?
    15·1 answer
  • The spinal cord begins at the Select one: a. cerebellum. b. medulla oblongata. c. foramen magnum. d. conus medullaris e. 1st cer
    9·1 answer
  • How would the world be without atoms?
    9·1 answer
  • Which of the following best defines velocity?
    13·2 answers
  • Like replication and transcription, translation is a process in which the information present within a nucleic acid template is
    11·1 answer
  • Glucose is an example of (choose Carbs or Lipids).<br> A. Carbs<br> B. Lipids
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!