1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
viktelen [127]
3 years ago
14

Which Mission saw the first successful docking of a spacecraft

Biology
2 answers:
lozanna [386]3 years ago
4 0
The answer is Gemini trust me
m_a_m_a [10]3 years ago
4 0
Hello!

I believe the answer is, Mercury.

Sorry if I'm wrong, have a nice day! :)
You might be interested in
How do interactions help dandelions to survive?
Sunny_sXe [5.5K]

Answer:

Interactions such as picking and blowing dandelions before they have became a flower helps to spread their seeds and letting more of them germinate. In another context, talking to flowers in general help because when you breathe out Carbon Dioxide, flowers and plants absorb it as it is what they need to grow.

4 0
3 years ago
By means of an example , explain how poaching leads to over utilisation of species.
Daniel [21]
Poaching refers to the illegal hunting of wild animals in violation of the laws which regulate hunting of wild animals. Over utilization refers to the exploitation of an animal to the point of extinction. Poaching activities include hunting and killing wild animals without licence, using illegal weapons to kill animals, killing animal out of season, etc. All these activities can lead to drastic reduction in the population of animal specie to the extent that the animals become extinct. A good example of an over utilized animal specie is passenger pigeon. 
4 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
What are reserves? Thanksssssssssssssssssss
snow_tiger [21]

Answer:

refrain from using or disposing of (something); retain for future use.

Explanation:

4 0
3 years ago
A natural phenomenon that typically influences climate over a period of one to two years is _______.
Andrews [41]

A natural phenomenon that typically influences climate over a period of one to two years is sulfur-rich violent volcanic eruption.

Without any doubt, the most plentiful volcanic gas from a volcanic eruption is water vapor, which is non-dangerous.

Nevertheless, notable volumes of carbon dioxide, sulfur dioxide, hydrogen sulfide as well as hydrogen halides can also be released from volcanic eruptions. This natural phenomenon generally influences climate over a period of one to two years.

The sulfuric acid creates a mist of minute droplets in the stratosphere that reflects the incoming solar radiation, an thus is responsible for cooling of the Earth's surface.

These droplets can stay in the stratosphere for about three years, circulating all over through winds and resulting in consequential cooling all over the world.

To learn more about volcanic eruption here

brainly.com/question/1622004

#SPJ4

4 0
2 years ago
Other questions:
  • The _____ regulates tobacco, dietary supplements, vaccines, veterinary drugs, medical devices, cosmetics, products that give off
    10·2 answers
  • During which process is the code on an mRNA strand read for a particular amino acid??
    15·1 answer
  • What is the most effective way to increase the oxygen content of air ?
    13·1 answer
  • When eating at a fast food restaurant what should you not do?
    9·1 answer
  • Do you think the sun is the future of energy production ?
    6·2 answers
  • Which form of life on land appears in the fossil record before all the others
    9·1 answer
  • N Domain Archaea, many archaea live in good environments in which other organisms could not survive.
    11·1 answer
  • (PLESE HELP ME) If a force of 20.0 N is used to lift a box a distance of 0.5 m, how much work is done? (INCLUDE THE UNIT for wor
    5·2 answers
  • And humans a cleft chin is stopping it and no left is recessive What will generations look like assume that men do its method of
    15·1 answer
  • During weeks 17-20, quickening occurs, which is when the __________. a. fetus’ sense of hearing is developing at a rapid pace b.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!