1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hunter-Best [27]
3 years ago
11

6. The first trial of a controlled experiment allows a scientist to isolate and test

Biology
1 answer:
Juli2301 [7.4K]3 years ago
3 0

Answer:

(3) a single variable

Explanation:

A control experiment can be defined as an experiment in which a condition assumed to be a probable cause of the effect is being compared to the same situation by the scientist without involving or using the suspected condition.

Controlled variable refers to anything or quantity such as group, person, event, etc., that is held constant by the researcher during an experiment and as such is limited.

The first trial of a controlled experiment allows a scientist to isolate and test a single variable.

Generally, most scientific experiments usually have a control group so as to avail scientists (experimentalists) an ability to compare the outcome of their test results before testing a single variable. This control group is not given the treatment or influenced by the same single (independent) variable as the experimental group.

Therefore, this is the reason why science completely or totally rejects any hypothesis which is not supported by observations, as well as the results obtained from control experiments.

This ultimately implies that, for any hypothesis to be acceptable in science, it must be supported by observations and the results of control experiments; this give rise to factual informations, theories and by extension solutions to problems.

You might be interested in
snakes rely on behavioral homeostasis to get warmer. what might a snake do in order to increase its body temperature.
Shalnov [3]

Answer:

They bask in the sun

Explanation:

In other words, they lay on their back to raise their body temperature.

I hope this helps!

8 0
3 years ago
Read 2 more answers
________ are neurons in the brain's visual system that respond to particular features of a stimulus.
forsale [732]

Answer:

The cells of the visual cortex are neurons in the brain's visual system that respond to particular features of a stimulus.

Explanation:

These neurons respond to stimuli presented to both eyes. Simple cells receive innervation directly from thalamic cells and respond to light stimuli with defined orientation and with specific configuration and location in the visual field. Complex cells also respond to the orientation parameter.  

These cells trigger action potentials when the visual stimulus appears within their receptive field.

7 0
3 years ago
Explain why a hydrogen atom can become either an ion or a part of a molecule
AleksandrR [38]
Because a atom can join my nuts and I will have 3 nuts.?YOUR WELCOME JK
8 0
3 years ago
What is the structure of the inferior vena cava
earnstyle [38]

Answer:

Structure. The IVC is formed by the joining of the left and right common iliac veins and brings collected blood into the right atrium of the heart. It also joins with the azygos vein (which runs on the right side of the vertebral column) and venous plexuses next to the spinal cord.

Source: common iliac vein; lumbar veins;

4 0
2 years ago
what is true in a saturated solution A. No more solute can be dissolved B. No more solvent can be dissolved C. No more solution
MrMuchimi
<span> A. No more solute can be dissolved</span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • Give an example of a specialized leaf system that is adapted specifically to its environment and explain how it works.
    8·1 answer
  • New Zealand has a population of 4,326,380 and has an area of 103,736 mi2028-02-04-03-00_files/i0370000.jpg while Australia has a
    12·2 answers
  • Process in which chemical energy is used to produce carbohydrates
    12·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Why are enzymes considered catalysts?
    7·2 answers
  • HELP IM IN ZOOM RIGHT NOW AND IM GONNA FAIL!!! ASAP ILL GIVE 100 POINTS
    15·2 answers
  • Pls help me 20 points for CORRECT answer
    7·1 answer
  • What tests can be used to diagnose phenylketonuria?
    13·2 answers
  • Consider plant roots and stems. Which tropism affects both these plant tissues? Which tissue experiences negative tropism versus
    13·1 answer
  • Whats the answer to this
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!