1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arlik [135]
3 years ago
10

In order for this code to represent a piece of DNA, which base must be replaced by thymine?

Biology
1 answer:
HACTEHA [7]3 years ago
7 0
I guess you forgot to add the picture or so.
Based on the Complementarity of the 4 nucleotides, The thymine must always be placed in  front of the Adenine, and the Cytosine must always be placed in front of the Guanine.
Any change in this rule causes the deformation of the DNA, and can sometimes cause fatal diseases like the melanoma (skin cancer) etc...

Hope this Helps! :)
You might be interested in
What is a diffusion through plasma membrane?
yan [13]
Diffusion is the movement of particles from a high concentration area to a low concentration area. Things that can go through a membrane are ions (charged), small polar molecules. Big molecules can't go through the membrane due to its large size and disrupting the membrane. Passive transport is the movement of substances acrpss the cell membrane w/o the use of energy. Active transport needs energy to move substances across a cell membrane.
7 0
2 years ago
A few years after a prey species population decreases, the _____. A. prey population will exceed carrying capacity B. predator p
ikadub [295]

Answer:

D. predator population will decrease

Explanation:

If the population of prey species decreases then the competition between the predator population will increase and natural selection will act on them. So nature will select those individuals among predators who are more fit and adapted and less fit individuals will die.

So a few year after the predator population will decrease as there are not enough prey to support the large population of predators which was present when prey were abundant. Therefore the correct answer is D.

3 0
3 years ago
Read 2 more answers
How is free water different from solute bound water (the key concept)?
Romashka [77]

Answer:

<h3><em>Water that can be extracted easily from foods by squeezing or cutting or pressing is known as free water, whereas water that cannot be extracted easily is termed as bound water.</em></h3>

<em></em>

4 0
3 years ago
Pls help ASAP I really need help
podryga [215]

It's B

And WHY YOU GOT A SAMSUNG COMPUTER BOIII NEED THAT MAC

6 0
2 years ago
What is the differences between boiling and autoclaving​
meriva

Explanation: Water baths reach a maximum boiling point of 100°C (212°F). Autoclaves ideally operate at higher temperatures of 120°C (284°F) and can go as high as 133°C (273 °F) Boiling in a water bath can take an hour or longer for effective sterilization to be achieved.

7 0
3 years ago
Other questions:
  • The data type that contains recorded measurements is called
    7·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What is an environmental variable that effects wing color in western white butterflies?
    12·1 answer
  • C6H12O6 + O2 → 6 CO2 + 6 H2O ΔG = –686 kcal/mol. This reaction represents cellular respiration. What happens to the energy relea
    6·2 answers
  • Which of the following happens at a joint?
    15·2 answers
  • At the end of telophase, what must occur?
    10·2 answers
  • A ruler has markings as shown below. Stefan uses this ruler to measure the length of a metal rod.
    5·2 answers
  • Explain why most volcanoes occur at plate boundaries and which two types of boundaries are most common?
    13·1 answer
  • What happens during photosynthesis? *
    14·1 answer
  • Where does FGF5 occur in the cell?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!