1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ohaa [14]
3 years ago
5

Which test would show positive for orange juice

Biology
1 answer:
NeX [460]3 years ago
6 0

Answer:

Lugol's test

Explanation:

Orange juice contains varied vitamins such as vitamin C. The test that shows positive results for orange juice is Lugol's test.

You might be interested in
Which characteristics can be used to classify the tree as a gymnosperm rather than “any other type of seed” plant?
erica [24]
1. Naked Seeds, Gymnosperm means 'naked seed' and these were the earliest trees to evolve. They do not produce flowers and have seeds which are directly exposed to the air for wind pollination. Pine cones are one example. For ease you might think of the gymnosperms as conifers, such as yew and Scots pine.
5 0
3 years ago
Read 2 more answers
A person has too much calcium ion in their blood what gland is most likely working correctly answers
jeka94

The parathyroid glands is group of tiny glands that is located in the neck which controls the calcium levels of the body. This gland produces parathyroid hormone (PTH). This hormone raises the blood calcium level by breaking down the bone causing the release of calcium. It also increases the ability of the body to absorb calcium from the food that we eat and it increases the ability of the kidney to hold on to calcium that would be lost in the urine later on.

The regulation of calcium levels in the body is crucial for the heart, nervous system, kidneys and bones to function normally.

Therefore, the answer is parathyroid glands.

4 0
3 years ago
A leaf electroscope is a device that indicates the existence of electric charge on an object. The leaves spread apart when an ob
amm1812

Answer: A

Explanation:

6 0
3 years ago
Read 2 more answers
The blood vessels that move blood in the direction of the heart are called
Leni [432]
I think the answer is Capilaries
Hope this helps
5 0
3 years ago
Which side of a mountain faces the moisture-rich ocean air?
Lena [83]
I think the the side where no snow falls, I hope I helped, sorry if I am wrong!
6 0
3 years ago
Read 2 more answers
Other questions:
  • Which conclusion can be made from the data in the table? The higher the temperature, the fewer chirps there will be in 10 second
    5·2 answers
  • Which sentence uses a demonstrative adjective that points out something near?
    14·1 answer
  • What is one function of muscle tissue?
    15·2 answers
  • Why can only traits controlled by genes be acted upon by natural selection?
    10·1 answer
  • This picture is illustrating
    15·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What is the season in the northern hemisphere when the North Pole points most directly toward the sun
    8·1 answer
  • What is the role of tRNA synthetase in the cell's cytoplasm?
    10·1 answer
  • There are two types of reactions in photosynthesis: light-dependent reactions and light-independent reactions. A group of biolog
    14·1 answer
  • . certain varieties of chrysanthemums contain 18, 36, 54, 72, and 90 chromosomes; all are multiples of a basic set of nine chrom
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!