1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Crazy boy [7]
3 years ago
10

In binary fission, the genetic material is pulled apart by ___________________.

Biology
1 answer:
notka56 [123]3 years ago
3 0
C) the cell membrane as the cell grows
You might be interested in
Scientific laws explain how and why something occurs on a scientific level.
Soloha48 [4]

Answer:

Answer. Scientific laws DO NOT explain how something, or why something happens. A scientific law can be thought of simply stating what happened. A scientific theory tries to explain how and why something happens on a scientific level.

Explanation:

3 0
3 years ago
Canadian geese can fly approximately 75 miles in 3 hours is this speed, velocity, or acceleration?
Olenka [21]

Answer:

Speed

Explanation:

Speed is a scalar quantity that refers on how fast and object is moving, speed can be thought of as the rate at which and object covers distance. An object with no movement at all has a zero speed.

Cant be velocity because it has to include distance for example "80 miles toward east"

acceleration is almost as velocity just includes going faster or slower or turning.

Hope that helps :)

8 0
3 years ago
Read 2 more answers
The diagram below represents the time a cell spends in the two main phases
tester [92]

the cell spends less time in A during cell division

5 0
3 years ago
An eeg shows bursts of rapid, rhythmic brain-wave activity during ________ sleep
tatyana61 [14]

Answer;

-Non-Rapid eye movement

Explanation;

-Non-rapid eye movement sleep is dreamless sleep. During NREM, the brain waves on the electroencephalographic (EEG) recording are typically slow and of high voltage, the breathing and heart rate are slow and regular, the blood pressure is low, and the sleeper is relatively still.

-NREM-2 occurs after NREM-1, an individual relaxes more fully and has about 20 minutes of NREM-2. It is characterized by its periodic sleep spindles, or bursts of rapid, rhythmic brain-wave activity. About half the night is spent in this phase.


4 0
3 years ago
A population of mice occupies a tree stump in a forest. During the last decade, there has been little change in the number of mi
guajiro [1.7K]
Unfortunately this question is incomplete as it does not provide any choices. However, there are certain ecological factors that can cause a population of mice to decrease quickly. One is an increase in predation. Many carnivorous animals prey on mice, including birds of prey, foxes and various other predacious mammals, as mice are small and high in number. This means a lot of mice are removed from the population through predation. Any increase in predator pressure could quickly disturb the balance in the mice population. Another factor is a disease. Some diseases can seriously deplete populations of animals, with the remaining hardier individuals developing immunity.  
4 0
4 years ago
Read 2 more answers
Other questions:
  • The outer core of the earth is primarily made of A solid metal. B molten metal. C primarily water. D unknown materials
    13·2 answers
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Constance's body is capable of producing insulin, but the insulin is misused. her condition is known as ____.
    9·2 answers
  • What is the base slope degree and summit slope degree of a shield volcano?
    13·2 answers
  • In a cladogram, when does a group of organisms branch off?
    5·1 answer
  • Homeostasis refers to
    6·1 answer
  • 5. What two systems are primarily involved in processing food? *
    6·1 answer
  • 6. What two places might a free-floating DA molecule end up?
    9·1 answer
  • Explain what incomplete dominance is
    13·2 answers
  • Adenosine triphosphate (ATP) is the energy currency of a cell. All of the following statements regarding ATP are true expect one
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!