1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
FinnZ [79.3K]
3 years ago
14

Name the seven continents of the world!

Biology
1 answer:
schepotkina [342]3 years ago
5 0

Answer:

Europe

Asia

Antartica

Australia

North America

Oceania

Africa

South America

Explanation:

You might be interested in
All strains of human papillomavirus (HPV) are capable of integrating their double-stranded DNA viral genome into host basal cell
Novosadov [1.4K]

Answer:

Oncogenes.

Explanation:

Cancer is the harmful disease that causes several death in the world. Cancer occur due to the mutation in the genes that are responsible for the regulation of apoptosis  and cell divisions.

The virus are also oncogenic in nature and can cause several different type of cancer. The human papilloma virus can be transmitted from the skin contact. The virus cause cervical cancer and genital warts. The integration of this virus into host genome increases the expression of viral oncogenes in the host DNA.

Thus, the answer is oncogenes.

5 0
3 years ago
Which of the following has mechanical energy?
marshall27 [118]
D. Visible light . Is the correct answer I hope this helps:)
4 0
2 years ago
Read 2 more answers
Which best describes the difference between osmosis and diffusion
Nana76 [90]
Well Osmosis is a process by which molecules of a solvent tend to pass through a semipermeable membrane from a less concentrated solution into a more concentrated one, thus equalizing the concentrations on each side of the membrane. And Diffusion<span> is the net passive movement of particles (atoms, ions or molecules) from a region in which they are in higher concentration to regions of lower concentration.</span>
3 0
3 years ago
Read 2 more answers
How has the new potato GMO been used to solve the problem of feeding the changing population?
Bad White [126]

Answer:w has the new potato GMO been used to solve the problem of feeding the changing population?

Explanation:

4 0
1 year ago
Read 2 more answers
Where does positive selection of t cells occur?
erik [133]
Positive selection of t cells occur in .the thymus
3 0
3 years ago
Other questions:
  • Describe two differences between b cells and t cells.
    13·1 answer
  • Which of the following best describes the transfer of nitrates and the impact on the environment and human health?
    9·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Silas is a man who is in his late seventies. he has a condition characterized by hypertension, obesity, and insulin resistance.
    6·2 answers
  • ____ ____ force is the type of intermolecular force that would be present between molecules of Cl2.
    9·1 answer
  • The beginning of the food chain starts with ____?
    6·2 answers
  • Throughout the lifespan, we change physically, cognitively, and psychosocially. This illustrates the notion that development is
    9·1 answer
  • Sarah is using a bleach and water mixture to clean the mold off of her deck. Her mixture contains 20 cups of water and 2 cups of
    6·1 answer
  • Which macromolecule is the body's first source of energy and is made up of our top 3 elements?
    13·1 answer
  • What type of charge does each atomic particle have?<br> Proton<br> Neutron<br> Election)
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!