1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bogdanovich [222]
3 years ago
14

During which stage of a cell cycle do the cromosomes replicate

Biology
1 answer:
ivolga24 [154]3 years ago
4 0
Interphase is the stage. Interphase is the first stage of the cycle where chromosomes are visible or able to see. Hope I helped and have a fantastic day. Please give me brainliest.
You might be interested in
What is the name of the chromosomal condition that is the result of an error in meiosis, causing a human to have three copies of
Olenka [21]
The name is Down Syndrome.
6 0
2 years ago
The residual volume is approximately ________l in an adult human.
Papessa [141]
About 1200 mL or 1.2L from what I have learned.
8 0
3 years ago
The following events are part of endochondral ossification. In which order do they occur?
devlian [24]

The order is calcification of matrix  >> cells differentiate into osteoblasts >> formation of the primary ossification >>  osteoclasts break down the spongy bone >> formation of the secondary ossification (5,3,1,2,4). It is a fundamental process.

<h3>What are osteoblasts?</h3>

Osteoblasts are cells of the bones, which act to generate bone matrix and modulate the process of mineralization of the skeleton.

Endochondral ossification refers to the mechanism through which the cartilaginous bones generate longitudinal growth.

This mechanism (endochondral ossification) is fundamental during fetal/embryo development.

Learn more about endochondral ossification here:

brainly.com/question/5325975

5 0
2 years ago
Define the components of blood and briefly describe their role.
Grace [21]
Tha main components in blood are the plasma, red blood cells, white blood cells, and blood platelets.

Plasma is like the main component that makes up most of the blood. It has a light yellow color and it carries many substances including nutrients, waste, hormones and more.

Red blood cells are the reason why blood is red in color. They have a hemoglobin inside them which can help carry oxygen for the tissues and organs. In order to maximize the oxygen carrying capacity, they don't have a nucleus.

White blood cells can be divided into phagocytes and lymphocytes. Their main function is to protect us from diseases. Phahocytes and engulf and digest bacteria, while lymphocytes can produce antibodies.

Blood platelets can cause blood clotting which can stop us from bleeding forever. They're not cells, but just fragments of cells. They also don't have nucleus since they're not complete cells.
8 0
3 years ago
Find the midpoint of the line segment joining the points ​(-4​,-1​) and ​(​-6,10​).
nekit [7.7K]

Answer:

hkafb I have to go to a meeting

5 0
3 years ago
Other questions:
  • ANSWER QUICKLY. THIS QUESTION COST A LOT OF POINTS! *where do crevasses form?* a. in the zone of fracture b.below the zone of fr
    15·1 answer
  • What does the term “membrane bound organelles mean?” What cell type are they found in?
    10·1 answer
  • John has been studying classification in class. He learned that Aristotle was the first to classify organisms. Aristotle classif
    12·1 answer
  • Can someone please help?
    8·1 answer
  • What is the variable in a scientific experiment that is affected by another variable, called the independent variable?
    5·1 answer
  • A female is born with attached earlobes, which is a recessive phenotype. Which of the following statements about her parents mus
    14·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Does 68% of the electrical energy in the United states produced by nuclear fuel
    10·1 answer
  • Explica brevemente en que consiste la teoría de la deriva continental y menciona los contenientes que se crearon a partir de la
    14·1 answer
  • Please help. Please be 100% sure of your answer. Thank you. ​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!