1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irinina [24]
3 years ago
12

Sperm can survive in the female reproductive system for six days, but they need to have 10 hours after ejaculation to undergo ca

pacitation. Ovulation typically occurs on day 14 of a woman's menstrual cycle. An ovulated egg can survive only up to 24 hours if it is not fertilized. Given this information, what days of a woman's sexual cycle would be a window of opportunity for an egg to be fertilized
Biology
1 answer:
sergeinik [125]3 years ago
4 0

Answer:

Five days prior to ovulation and day of ovulation represents a six day fertile window of a women’s cycle

Explanation:

In the five days prior to ovulation and day of ovulation, the chances of conception are high. These six days represents the fertile window of a women’s cycle during which the sperm with a life span of five days and egg with a life span of 24 hours can fuse. However, likelihood of conceiving increases if two individuals mate in the first three days of these six days fertile window of women’s cycle.  

You might be interested in
Choose all the answers that apply.
BARSIC [14]

Answer:

has two recessive genes ............option A

5 0
3 years ago
Is anyone good at science please help for brainliest.
Dafna11 [192]

Answer:

eukarya

Explanation:

so long as that stands for eukaryotic

fungi is eukaryotic

other 2 are multicellular, and therefore eukaryotic

if u don't like the first explanation, the second one is process of elimination

archaebacteria is a kingdom, so it can't be that, same with plantae.

fungi isn't a bacteria so it can't be that either

only option remaining is eukarya

6 0
3 years ago
The amino
zzz [600]

Answer:

1. Proteins.

2. Peptide Bonds.

Explanation:

I majored in Biology

3 0
3 years ago
How is radioactive dating important for providing evidence of evolution?
jeyben [28]

Answer:

radioactive dating? what the hell is that?

Explanation:

7 0
2 years ago
Our body cells undergo the process of the cell cycle and mitosis daily. Cells undergoing mitosis are important for growth and re
kotykmax [81]
The “S” phase which is the phase of DNA synthesis
7 0
3 years ago
Other questions:
  • On the graph, with X and Y axes
    8·1 answer
  • The majority of americans with diabetes have ____________ , formerly called ____________ .
    9·1 answer
  • Does taking the reciporcal of both sides flip an inequality
    12·1 answer
  • An animal dies and falls into a river. Over time sand, rock, and other material settle on top of the animal remains, completely
    13·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which part of the peripheral nervous system is most important in helping you to walk?
    7·2 answers
  • Which combination of features is found in most plant and animal cells? #1 Cytoplasm, mitochondria, ribosomes #2 Rough endoplasmi
    8·1 answer
  • 39. What makes up proteins and what bonds them together?
    9·1 answer
  • Where does the spinalthalamic tract cross the spinal cord.
    10·1 answer
  • microorganisms occur everywhere in nature and have several requirements to grow. what is one of these requirements? select all t
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!