1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataliya [291]
3 years ago
10

Why are there two sets of phases during meiosis, but only one during mitosis?

Biology
1 answer:
sergey [27]3 years ago
6 0

Bcoz.. In meiosis ti change ploidy of cell from diploid(n) to haploid(2n) .. 2 division occur.. This helps in formation of haploid gametes.. When two gametes fuse.. They form diploid (2n) zygote.

On the other hand..

There is only one division in mitosis...bcoz no change in ploidy.. Use in growth. Bcoz it retains nucleo-cytoplasmic ratio.

You might be interested in
How do we classify finger prints?
Aloiza [94]
Classifying Fingerprints. Once the fingerprints are taken and labeled, forensic scientists use a classification system to identify them. The three basic fingerprint patterns are Whorl, Arch, and Loop. There are more complex classification systems that further break down the pattern to plain arches or tented arches. Hope this helps
6 0
2 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Levels of HDL, LDL, and triglycerides in the blood: are simple traits. are influenced by many different genes. tend to cluster i
VLD [36.1K]

Answer:

are influenced by many different genes

Explanation:

A quantitative trait is a given phenotypic trait influenced by the combined effects of many genes and its environment. A quantitative trait locus (QTL) is a region of DNA (i.e., a <em>locus</em>) associated with the variation of a quantitative trait. In the last years, some QTLs correlated to the variation of HDL, LDL, and triglycerides levels were mapped in different genomic regions, thereby showing that these complex traits are regulated by the interaction of multiple genetic <em>loci</em>.

7 0
3 years ago
The number of proteins in its nucleus determines an atoms
Kobotan [32]
identify as an element
8 0
3 years ago
Dna fragments that have matching sticky ends are joined by covalent bonds formed by the action of
rewona [7]
DNA Ligase enzyme.

Hope i helped! Please mark Brainliest if u can :)
5 0
3 years ago
Other questions:
  • While mRNA strands are being created a sequence is sometimes miscopied. What is the best possible outcome, the worst possible ou
    9·1 answer
  • Which part of a molecule determines the type of amino acid?
    5·2 answers
  • Antlions can experience competition when...?
    7·2 answers
  • During which stage of interphase does the cell make additional proteins and organelles in its last preparations for cell divisio
    10·1 answer
  • What are the cell structures that are needed for photosynthesis and the cell structures that are needed for cellular respiration
    8·1 answer
  • What neurotransmitter systems do methylated amphetamines affect?
    12·1 answer
  • This is a type of symbiosis where one organism benefits but the other is hurt.
    15·1 answer
  • A nucleotide consists of
    5·2 answers
  • 14. What do the embryos of different vertebrate species have in common?​
    14·1 answer
  • How do big rocks break down into smaller rocks?​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!