1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ch4aika [34]
3 years ago
12

the mutation of the brca1 gene normally functions to ensure? a)breast cancer cells duplicate b)suppress tumor function c)the per

son will develop breast cancer
Biology
1 answer:
DedPeter [7]3 years ago
3 0
I believe the answer is B!
You might be interested in
Which step happens first in DNA replication?
Scrat [10]
The first step is The replication fork forms (d)
3 0
3 years ago
Read 2 more answers
What two environmental factors influence the shape of proteins?
kykrilka [37]

Answer:

The two environmental factors are temperature and pH and with that, denaturation occurs. In other words, temperature and pH would affect the protein structure, which it would change their shape and possibly it won't perform its normal function.

Explanation:

4 0
3 years ago
How can biotechnology be used to develop medical treatments and give an example?
BabaBlast [244]

Answer:

These products help treat and prevent diseases. From the Ebola vaccine to mapping human DNA to agricultural impacts, medial biotechnology is making huge advancements and helping millions of people. Some of the most recent uses of biological tech is work in genetic testing, drug treatments, and artificial tissue growth

Explanation:

5 0
3 years ago
Help me with thissssss
katen-ka-za [31]

Answer:

cevap sirayla

Explanation:

a prodüct

b substraite

c enzyme

d enzyme s c

e producte

4 0
3 years ago
Jade hears a rattle. When she turns around she sees a rattlesnake inches from her leg. Her pupils dilate, her heart pounds, and
k0ka [10]

Answer:

Fight or flight response.

Explanation:

Fight or flight response is also known as hyper arousal response. This response is mainly generated in case of attack and harmful event.

Jade hears a rattle sound and sees a rattle snake as she turns turns around, this is a type of harmful event or fear for Jake. This condition causes the dilation of pupil, sweat and heart pounds in Jade's body. The fight and flight response has been generated in Jade's.

8 0
3 years ago
Other questions:
  • _________ receive messages from other neurons and _____________send messages to other neurons.
    9·1 answer
  • which organic compounds would be the best to analyze in order to determine if two species are closely related?
    7·1 answer
  • The resource speaks of the atmosphere as if it were living. In the sense that as the earth's surface is heated by the light from
    12·1 answer
  • Which is the best definition of activation energy?
    12·2 answers
  • Answer the questions. ​
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • In the 18th century, Carolus Linnaeus classified organisms based on their structural similarities. Modern classification determi
    13·1 answer
  • In humans, an egg develops into a male offspring if it
    13·1 answer
  • Explain the physics of light as it relates to photosynthesis. What is a pigment, what is a photon?
    15·2 answers
  • Nicotine is a drug that stimulates nicotinic receptors. It will have an effect __________.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!