1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill115 [55]
2 years ago
13

briefly explain what happens to energy and to molecules when bonds are formed and broken in molecules of ATP and ADP ( explain a

t a 6th grade level )
Biology
2 answers:
joja [24]2 years ago
5 0
ATP has three phosphates attached to it. In order to form ADP, one of the phosphates is released. To form ADP back into ATP, the phosphate has to be reattached.
Nikolay [14]2 years ago
4 0
Hello! ATP stands for adenosine triphosphate, and ADP stands for adenosine diphosphate. The difference between the two molecules is that ATP has three phosphate group, and ADP has two phosphate groups. ATP is an unstable molecule, which means it will release energy when it becomes reduced to ADP, meaning it will break off one of its phosphate groups. Hope this helps, and let me know if you have any questions! ^-^
You might be interested in
What does carrier mean
xxTIMURxx [149]

Answer:

a large warship that carries planes and has a long flat deck for takeoffs and landings

Explanation:

8 0
3 years ago
Read 2 more answers
Abductors enable efficient bipedal motion by contracting parts of the gluteals that attach to the ilium and allow humans to step
miss Akunina [59]

Answer:

a. True

Explanation:

Since , abductions, particularly the minimus and gluteus medius , are active on the side of the leg which is in contact with the ground . This is to avoid the tendency of gravity to cause the downward motion of the hip on the opposite side . In addition, the lateral muscle and  paraspinal muscles  of the trunk are active on the side of the swinging leg to avoid the downward motion of iliac crest on side .

5 0
3 years ago
ANSWER QUICKLY!!
horrorfan [7]

Answer: A

Explanation:

 Because its the main difference between the 2

7 0
3 years ago
Read 2 more answers
The forelimb structur seen in both bat wings and human arms is very similar to that of an extinct land animal called eusthenopte
dsp73
<span>b.Eusthenpteron might be a common ancestor of bats and humans.

Hope this helps!

-Payshence xoxo</span>
4 0
3 years ago
Why is eating local food instead of food produced elsewhere often helpful to the environment?
leva [86]
Locally grown food creates important economic opportunities, provides health benefits and helps to reduce environmental impact. It also helps bring the community together and gives people the opportunity to make a difference. Additionally, many people feel local food tastes better and lasts longer. So the answer will be C
8 0
3 years ago
Other questions:
  • Many male birds will expend A great deal of energy building nests. Females will mate with the males who build the best nest. Thi
    6·1 answer
  • Why is the nervous system referred to as a communication system?
    6·1 answer
  • Which of the following processses causes the release of nitrogen back in to the atmosphere?​
    12·1 answer
  • HELPPPP
    11·1 answer
  • Where do the instructions for making proteins come from
    10·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • A drought is a period of unusually low
    8·1 answer
  • The graph shows atmospheric carbon dioxide levels over time.
    10·1 answer
  • Is plate-based or a meat-based diet is more nutritious
    8·1 answer
  • When does separation of homologous chromosomes occur.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!