1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xenn [34]
2 years ago
14

Does mitosis only occur in humans? Pls help!

Biology
1 answer:
olga nikolaevna [1]2 years ago
3 0
No, it doesn't. It also occurs in animals and plants.
You might be interested in
One character in peas that Mendel studied was yellow versus green seeds.
weqwewe [10]

Answer:

Mendel was an Austrian monk whose researches laid the foundation of genetics. The experiments conducted by Mendel led him to the foundation of two laws which are named as the law of segregation and law of independent assortment.

According to the law of segregation, the two alleles of a gene segregate during the time of gamete formation and there are 50-50% chances of each of the alleles to be received by the gametes. Hence, there are 50% chances for Y gametes to be produced and 50% chances for y gametes to be produced.

3 0
3 years ago
The stem of a plant grows_________from the pith. outwards or inwards
larisa86 [58]

The stem of a plant grows_________from the pith. <u>outwards</u> or inwards

4 0
3 years ago
What arteries do the highlighted vessels branch into? what arteries do the highlighted vessels branch into? segmental renal cort
Soloha48 [4]

The highlighted vessels branch into arcuate arteries.

Arcuate arteries- The interlobar arteries bend over to produce imperfect arches at the point where the cortex and medulla meet. The arcuate artery is the name given to this portion of the blood supply as a result. The arcuate artery divides into several tiny radial arteries, which diverge at right angles and provide blood to the cortex.

Vessels- In the blood, vessels (canals) move waste away from organs and tissues and carry nutrients to those tissues. The vasculature's participation in oxygenating the organism serves as one of its main functions and important roles.

To know more about the Arteries, click on the below link,

brainly.com/question/14040789

#SPJ4

8 0
1 year ago
Which organelle contains chlorophyll and is the location for photosynthesis?
sweet-ann [11.9K]

Answer:

Choloroplast

Explanation:

The choloroplast hosts the enzymatic machinery that carries out photosynthesis. These proteins are embedded in the thylakoid membranes of the chloroplast. Of these proteins PSII and PSI contain chlorophyll molecules.

3 0
2 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • Identify the cell stage of erythropoiesis indicated by "e."
    14·1 answer
  • An organism genotype is its
    13·2 answers
  • Which of the following might result in a human zygote with 45 chromosomes?A) an error in either egg or sperm meiotic anaphaseB)
    14·1 answer
  • A freshwater is a type of ecosystem. Grasses, fish, wading birds, frogs, and alligators live together in fresh water marshes. Pi
    7·2 answers
  • What is a benefit of using renewable resources?
    8·1 answer
  • Consider the status of the black-footed ferret. What is the MOST logical contributing factor to its endangered status? A) The ex
    13·2 answers
  • Explain climate change in the past 100 years
    10·1 answer
  • Johanna learns that the Law of Conservation of Energy states that energy is conserved, never lost. Which of the following best d
    10·2 answers
  • Which substances will float on water? (there are eleven, name all of them)
    13·1 answer
  • Untreated hyperemesis can lead to preterm birth. what is the cause of the preterm birth?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!