1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
12345 [234]
3 years ago
5

The sliding filament model is our best explanation of how a skeletal muscle shortens. Based on your knowledge of the structure o

f the sarcomere and the changes that occur in the sarcomere with muscle contraction, explain the evidence that supports the sliding filament model.

Biology
1 answer:
Veseljchak [2.6K]3 years ago
7 0

A sacromere is a segment between two adjacent Z discs and are essential for the striated structure of the cardiac and skeletal muscles.

<u>Explanation:</u>

The Z disc is surrounded by the I band made of thin filament called actin. The I band is followed by the A band made up of thick filament called myosin. When the muscles contract the actin and the myosin become superimposed/overlapped.

The sliding filament model explains the contraction of the sacromere in which the Z discs move closer due to the overlapping of the thin and thick filaments. Thus the I band moves close to the A band which remain the same length as shown in figure.

You might be interested in
You are giving ventilations to a 5-year-old child through a resuscitation mask, you should give 1 ventilation about every
Yuki888 [10]
You should typically give ventilation’s to a young child every 30 seconds.

Hope I could help! :)
7 0
3 years ago
Which is a modification into the spine in a cactus plant? A. Stems B. Leaves C. Buds.
Fynjy0 [20]
I think the correct answer from the choices listed above is option B. A modification of the leaves into the spine in a cactus plant can be seen The spines are modified leaves. It helps defend the plant and also reduce the surface area which helps limit loss of water.
6 0
3 years ago
Read 2 more answers
The youth movement originated with the ___ the generation born after ___
VLD [36.1K]
I believe that the youth movement originated with the baby boomers, the huge generation born after the world war II. By 1970, 58.2 % of the population in America was under the age of 35 years. The economic boom of the 1950s meant more families could afford to send their children to College. College life gave the young people a sense of freedom and independence. It was on college campuses across the nation that youth protest movements began and reached their peak. 
7 0
3 years ago
Which life cycle describes a plant that reproduces asexually and sexually?
Artemon [7]
I think it's D because I suppose that 'all its chromosomes' equals diploid
5 0
3 years ago
Read 2 more answers
What is separated during Anaphase I...Is it chromatids or homologous chromosomes?​
natita [175]

Answer:

Homologous Chromosomes (tetrad)

Explanation:

Sister chromatids remain attached at that time.

5 0
3 years ago
Other questions:
  • A scientist determines that there is 25% Cytosine in a double stranded piece of DNA.
    7·1 answer
  • How does attitudes and values influence effective communication
    5·1 answer
  • Which statement explains the relationship between the density of a material and its movement in Earth’s interior?
    9·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • How to avoid dehumanization in the hospital
    14·1 answer
  • In rabbits, short hair (S) is dominant over long hair (s). What genotype and phenotype ratios are expected from a cross between
    5·1 answer
  • Which of the following is a function of the cell membrane?
    11·1 answer
  • What are three things you learned about the
    9·1 answer
  • How Many Milligrams Are In 1455 grams? <br> First To Answer Gets Brainliest 3
    9·2 answers
  • Short notes on dispersal of seed
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!