1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikdorinn [45]
3 years ago
5

Hydrogen fuel cells burn with _______ and produce _______.

Chemistry
2 answers:
guapka [62]3 years ago
6 0

Hydrogen fuel cells burn with Oxygen and produces Water.

It is commonly used to produce electricity.

AveGali [126]3 years ago
5 0

Answer:

with oxygen to form water

Explanation:

In a flame of pure hydrogen gas, burning in air, the hydrogen (H2) reacts with oxygen (O2) to form water (H2O) and releases heat. If carried out in atmospheric air instead of pure oxygen (as is usually the case), hydrogen combustion may yield small amounts of nitrogen oxides, along with the water vapor.

You might be interested in
List the ions in solution in the electrolysis of conc.sodium chloride<br>​
Licemer1 [7]
Chloride ions Cl –(aq) (from the dissolved sodium chloride) are discharged at the positive electrode as chlorine gas, Cl 2(g) sodium ions Na +(aq) (from the dissolved sodium chloride) and hydroxide ions OH –(aq) (from the water) stay behind - they form sodium hydroxide solution, NaOH(aq)
5 0
3 years ago
A 4-g mass of NaOH is dissolved in 5mL of water.
lapo4ka [179]
Molar mass NaOH = 40.0 g/mol

Volume in liters of solution :

5 mL / 1000 => 0.005 L 

number  of moles :

4 / 40 => 0.1 moles

M = n / V

M = 0.1 / 0.005

 = 20 mol/L or 20 M

hope this helps!
6 0
3 years ago
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
When an object travels no distance in a large amount of time, the object's speed is _____. A. fast B. slow C. zero
Nata [24]

zero because its not going anywhere its stationary

hope this helped ^_^

8 0
3 years ago
Read 2 more answers
The reaction of hydrogen with oxygen produces water.
Anika [276]
Make a ratio of the number of moles and do the calculations. Do you get it?

5 0
3 years ago
Other questions:
  • According to the periodic table, which statement correctly describes the change from a neutral atom of an element to its ion?
    6·2 answers
  • Write the name of the following compound: H3PO4
    15·2 answers
  • Complete the chart. (Remember to enter a "0" if necessary.) Atomic Number: 10 1s: 2s: 2p: 3s: 3p: 4s: 3d: 4p: 5s:
    7·1 answer
  • What is the change of state involved in combustion of an alcohol and it’s entropy ?
    14·1 answer
  • Which of the following describes the sharing of a nonbonding electron pair on a nitrogen molecule with an oxygen atom, resulting
    5·1 answer
  • Sally's index finger is 85 mm long, how long is her index finger in decimeters?
    6·2 answers
  • A or B or C or D, fassst plzzz
    14·2 answers
  • The velocity (speed) of an object was determined to be 45 miles per
    12·2 answers
  • 1- If an atom lose 2 electrons it will give………… A) Ion with 2+ charge called cation C) Ion with 3+ charge called cation B) Ion w
    9·2 answers
  • Is this right????????????
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!