1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katen-ka-za [31]
3 years ago
10

In a species of bird, the males compete to try to fertilize the females. which trait would you expect these birds to have?

Biology
2 answers:
laiz [17]3 years ago
8 0

Answer:

Males that are much larger than females

Explanation:

apex

viktelen [127]3 years ago
4 0

The answer is D. Because the bird has to be noticed and the brighter the feathers the more likely the chance to be noticed.

You might be interested in
What occurs when a ball falls from a balcony
madreJ [45]
It uses its potential energy and converts it into kinetic energy as it falls (the lower it is during the fall it will be mostly kinetic, however the higher it is during the fall it will be mostly potential energy)

4 0
3 years ago
Which of these are NOT found in plant cells?
marin [14]

Answer:

B. centrioles

Explanation:

Plant cells have cell walls, cell membranes and also contain mitochondria along the chloroplasts.

4 0
3 years ago
Read 2 more answers
What is the type of asexual reproduction that occurs in yeasts?
34kurt

Answer:

Budding is the asexual reproduction that happens in yeasts

3 0
3 years ago
Read 2 more answers
What is true about the struction of the plasma membrane
SpyIntel [72]
The structure of the membrane, is the Phospholipid Bilayer. I hope this helps
3 0
3 years ago
Rift valleys can form when fractures in the Earth's crust widen. The valley walls slowly move at a rate of only a few millimeter
Lilit [14]
My best answer would be C I hoped I helped sry if you get it wrong
4 0
3 years ago
Read 2 more answers
Other questions:
  • It is hard to believe, but the desert and the tundra have a lot in common! The most obvious is that both biomes have little avai
    13·2 answers
  • draw a labelled diagram of the condition of one of the vegetable cells after being immersed in the concentrated salt solution fo
    15·1 answer
  • How do different populations maintain community stability and diversity?
    14·1 answer
  • How do antibiotics help your immune system deal with infectious agents?
    11·2 answers
  • Why should American citizens learn about the bombings of Hiroshima and Nagasaki?
    11·1 answer
  • Lichens are an example of what species?
    14·2 answers
  • What are the phenotypes for YY, Yy, yy. Where Yellow (Y) hair is dominant to blue (y)?
    8·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Solutions to stop dams
    14·1 answer
  • Jessica is watching a storm approach her house and sees grey clouds, lightning
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!