1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natta225 [31]
3 years ago
5

How are the starting materials and products of cellular respiration and photosynthesis related?

Biology
1 answer:
den301095 [7]3 years ago
7 0
Respiration uses oxygen to make CO2, which goes back into photosynthesis to make oxygen. The end products of each basically cycle back into each other.
You might be interested in
Type of plastid contains oarnge pigment
Serga [27]
<span>hromoplast is the generic term but is usually used to refer only to those plastids that do not have chlorophyll.</span>
3 0
3 years ago
Explicamos los factores que
gladu [14]

Answer:

Contaminación por quema de combustibles fósiles en vehículos, deforestación y uso de químicos en agricultura.

Explicación:

La contaminación por quema de combustibles fósiles en vehículos, la deforestación y el uso de químicos en la agricultura son los factores que generan problemas ambientales en nuestra comunidad. La quema de combustibles fósiles en vehículos e industrias libera gas de dióxido de carbono que aumenta la temperatura del área, la tala de árboles para uso doméstico tiene un efecto negativo en el medio ambiente. En nuestra comunidad, los productos químicos se utilizan para obtener una mayor producción que también contaminan los cuerpos de agua y los animales acuáticos afectados.

5 0
3 years ago
Which measures the mass of an object
Makovka662 [10]

Mass is measured by using a balance comparing a known amount of matter to an unknown amount of matter. Weight is measured on a scale.

8 0
3 years ago
In what situation does anaerobic respiration take place
Ierofanga [76]
<span>When there is no oxygen, or the organism cannot use oxygen for respiration. 

</span>
7 0
3 years ago
Read 2 more answers
Jamal drew a flow chart to show how the carbon in his brain tissue originated as co2 in the atmosphere. interpret his model.
bezimeni [28]

We have heard about Respiration. In human beings, respiration is a cellular activity which takes place in the presence of oxygen and in result produces carbon dioxide. Jamal model is a clear manifestation of that process. Medulla is the region of a brain that controls the respiration activity. When we breathe we take in oxygen and the excess amount of carbon dioxide is removed from out body.

Brains cells have capability to detect the carbon concentration in blood and add excess amount of carbon from body to the air.  


8 0
3 years ago
Other questions:
  • In how many different ways can 7 swimmers be lined up for a race?<br> 5040<br> 42<br> 332<br> 72
    5·1 answer
  • What anatomical similarities do humans share with apes?
    14·1 answer
  • Which part of the endomembrane system provides a mechanism for transporting proteins from the rough er to the Golgi apparatus?
    15·2 answers
  • Explain the relationship between the loss of Arctic ice and the sustainability of human populations
    9·1 answer
  • 1. How have humans evolved in regards to their brain size, jaw
    14·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • If the finches that colonized the Galápagos from South America had different allele frequencies when compared to the parental po
    6·1 answer
  • Which of the following is the dominant sense in chimpanzees?
    13·1 answer
  • How does blood help maintain homeostasis in the body
    8·1 answer
  • Is a echinodermata biodiverse
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!