1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alukav5142 [94]
3 years ago
10

When prokaryote's _____ is copied

Biology
1 answer:
rewona [7]3 years ago
3 0

Answer:

Replication occurs before a cell divides to ensure that both cells receive an exact copy of the parent’s genetic material

Explanation:

You might be interested in
When the nursery at the hospital caught on fire, everybody rushed out with a baby. Unfortunately, after the fire was put out, th
Veseljchak [2.6K]

Answer:

baby #1 goes to family 2

baby #3 goes to family 1

and baby #2 goes to family 3

Explanation:

its simpler then it looks☺

8 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
What BEST describes the role of water molecules in photosynthesis?
kolbaska11 [484]

Answer:

Light provides … Briana notices the electrons that the water molecules release.

6 0
3 years ago
___populations can have the same species name
Jobisdone [24]

Well it's impossible for different population to have the same name.

So I would say this for the answer.

One population can have the same name.

5 0
3 years ago
They are always harmful but never beneficial or neutral.
irga5000 [103]

Answer:

Are you referring to symbiotic relationships between organism? If so, the answer would be parasitism.

One organism, a parasite, takes advantage of another organism at the expense of the host organism.

Ex. A tick bites a dog for blood to use as food. The dog gets an uncomfortable bug bite and the dog might catch a tick borne disease.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which statement best describes the relationship of photosynthesis and energy
    15·1 answer
  • I need help on sun review answer key.
    9·1 answer
  • What is the most important role of hydrogen bonding between water molecules?
    7·1 answer
  • What phenotypic ratio would you expect as a result of a test cross between two individuals where 9) one that is homozygous reces
    5·1 answer
  • Imagine you are a scientist testing how exercise can affect a persons heart rate. What is the independent variable and the depen
    5·1 answer
  • The discovery of cells is most directly linked to the
    7·1 answer
  • Gina planted mustard seeds in three cups. She placed the first one on her window sill, the second one under a shaded tree, and t
    5·1 answer
  • AQUATICS SCIENCE I need help
    10·1 answer
  • Describe 3 characteristics that are not inherited, but affect survival
    14·2 answers
  • 1. Which of the following is an example of sexual reproduction? *
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!