Answer:brain
Spinal cord
Explanation: the two make up the nervous system
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
Answer:
Mutations in genetic code occurs when DNA is being duplicated.Any changes in the base pairs leads to mutations by trasition or transversion. Change in amino acid leads to change in sequence and thus, mutation. This si carried on to new generation, if it takes place in germ cells.
Answer:
The waves erode seashells and rocks on the shore into small granuels called sand.
Explanation:
Answer:
Scientists are studying a group of ant colonies in the Arizona desert. Which question about the ants can be answered scientifically?
Explanation:
The correct answer will be option- Does the amount of sunlight in a day affect how much food the ants eat that day.
Explanation:
A scientific method is a systematic approach to understand and explain any natural phenomenon in nature. The scientific method involves making, ask a scientific question, do background research and propose a hypothesis which could be tested to produce a real answer to the scientific questions.
In the given question, the scientist wants to study the ants in the desert through scientific method. The possible question that could be answered will be the how the amount of light can affect the quantity of food consumed by ants as the amount of food can be studied through the experiments by proposing a hypothesis.
Thus, the selected option is the correct answer.
