Answer: A plant cell will have a cell wall, while a animal cell won’t.
Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'
Biotic factors are those that are living in an ecosystem, such as plants and animals, while abiotic factors are those that are not, such as rocks, temperature, water, sunlight, soil etc.
C is correct for number 2 because broadleaf trees are a biotic factor, while precipitation, or rainwater, is abiotic.
A is incorrect because both are biotic factors, since both are living
B is incorrect because both are abiotic factors, since both are nonliving
D is incorrect because both are biotic factors, since both are living
In the deep waters of the ocean, coral reefs are found in abundance. Algae live on these coral reefs, providing nutrition and producing pigments that give color to the corals. The corals offer shelter to the algae. So, they share a association. Climate change has led to increased temperatures and has caused the corals to throw away the algae living inside them. This action causes the corals to be bleached because of a lack of pigment. This change will lead to a decrease in the coral growth, reduced fecundity and can cause death of corals.
<span>Glucose and ketone bodies are not detected in urine since it not a waste product. Our body needs gluose and ketone bodies, they serve as a major source of energy and they help in our metabolism. However, too much of these isn't good for the health and may cause serious disease like diabetes. -ahnnahly</span>
