1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ANTONII [103]
3 years ago
11

The difference between the energy-investment and energy-harvesting steps of glycolysis​

Biology
1 answer:
motikmotik3 years ago
6 0

Answer:

this is the answer if we can the this answer then write

You might be interested in
What are two ways in which the value of soil can be reduced?
Dovator [93]

Fertile soil is valuable because there is a limited supply. Less than one eighth of land on Earth has soil that are well suited for farming.

The thick, fertile soil of the prairies took many thousands of years to develop.

The two ways that the value of soil can be reduced is help use soil correctly, peanuts were once a corp to help soil, and still can be. The soil value recycle rocks and bedrock.

The value of soil is reduced when it loses its fertility and when topsoil is lost due to erosion. Soil can be conserved through contour plowing, conservation plowing and crop rotation. The thick mass of tough roots at the surface of the soil.

6 0
3 years ago
Villi are tiny finger-like projections present in the inner wall of the small intestine. They help in the movement of partially
Eva8 [605]
They Increase the surface area available for the absorption of nutrients

6 0
3 years ago
Read 2 more answers
There are twenty amino acids in living organisms. Ten of these are referred to as essential amino acids. Why are they called ess
Dahasolnce [82]

Answer:

B

Explanation:

3 0
3 years ago
Read 2 more answers
Human ABO blood type is determined by a single gene that comes in 3 distinct alleles: IA , IB , and i. The IA and IB alleles are
alexandr402 [8]

Answer:

given, mother and father are heterozygotes.

let, father has B blood group and mother has A blood group.

then their heterozygous  genotypes are --

father = iB, iO  and mother = iA, iO

punnett square will be,

        iB        iO

iA     iA iB     iA iO

iO     iB iO    iO iO

the genotypes of their progeny will be, iAiB ,  iAiO ,iBiO and iOiO

and phenotypes will be 3 are heterozygous and 1 is homozygous.

5 0
3 years ago
What is the transamination reaction? What is the cofactor required for the transamination reaction?
brilliants [131]

Answer:

Transamination reaction:

Transmaination reaction may be defined as a type of chemical reaction that involves the transfer of an amino group to the another keto acid fort the formation of new amino acid. The non essential amino acid can be easily converted to essential amino acid by this transmination reaction.

This reaction is important for the important mteabolic pathways of the body. The cofactor required for the transamination reaction is pyridoxal-5'-phosphate. This cofactor also works as a derivative of vitamin B6. This cofactor is converted to pyridoxamine-5'-phosphate during the reaction.

6 0
3 years ago
Other questions:
  • Why is it important that your heart rate returns to resting levels as quickly as possible?
    13·1 answer
  • How do the bees pollinate
    14·2 answers
  • 13. a liver cell and a nerve cell in you body has the same dna. why does the liver cell have different structures and functions
    7·1 answer
  • 3. Draw a circle on a flat surface. Look at it from the side. What do
    9·1 answer
  • Which of the following philosophical approaches is modern evolutionary biology based upon?
    12·1 answer
  • The lymphatic system is closely associated with the
    11·1 answer
  • What is the relationship between proto-oncogenes and oncogenes?
    8·1 answer
  • Briefly explain what happens during Meosis 1.
    12·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Secession results in a climax community why is it called a community And not a population
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!