1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
max2010maxim [7]
4 years ago
14

The word atom means invisible?

Chemistry
1 answer:
horsena [70]4 years ago
6 0
The word atom<span> is derived from the Greek </span><span> 'atomos' - </span><span>“indivisible.”
But the word 'atom' itself just means the smallest particle, not necessarily invisible. 
</span><span>
</span>
You might be interested in
How Many Atoms Are In 356.13 Grams Of Sn
s344n2d4d5 [400]

<span>There are three atoms of Sn (Stannous or Tin) in</span> 356.13 g of Sn.

<span>One atom of Sn has the atomic mass (m</span>ₐ<span>) of </span>118,71u which means:

356.13/118.71=3 atoms of Sn

The mass number (symbol A) also called atomic mass number or nucleon number is the total number of protons and neutrons in an atomic nucleus. It determines the atomic mass of atoms and it is in the periodic table.

8 0
3 years ago
An atom with atomic number of 6 would have how many protons?
aalyn [17]

Answer:

6

Explanation:

Any atom with the atomic number 6 is carbon and has 6 protons

4 0
4 years ago
Read 2 more answers
If two gases a and b in separate 1 liter containers
Anton [14]

The pressure exerted when both gases are put together in a single 1 liter container is 5 atm.

<h3>What is pressure?</h3>

Pressure is the force exerted by any object on another object.

Given that, a and b separate 1 liter containers and exert pressure of 2 atm and 3 atm respectively.

When both gases a and b exert together, the pressure then

2 atm + 3 atm = 5 atm.

Thus, the pressure exerted when both gases are put together in a single 1 liter container is 5 atm.

Learn more about pressure

brainly.com/question/12977546

#SPJ4

7 0
2 years ago
Significant figures
Sergeu [11.5K]

Answer:

go look for that on google

Explanation:

4 0
4 years ago
Weight in grams of NaCl
Allisa [31]

Answer: 58.44g

Explanation: The molar mass of NaCl is 58.44g.

7 0
4 years ago
Read 2 more answers
Other questions:
  • What is the electron configuration of an element with atomic number 15 ? Please help
    11·2 answers
  • How many moles of Ag will be produced from 46.0 g of Cu, assuming AgNO3 is available in excess?
    14·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Are these gases lighter than or denser than air? How can you tell?
    13·1 answer
  • These four ELEMENTS were found in early earth and they make up all living things.
    9·2 answers
  • Which element has a partially filled F orbital? <br><br> Sm <br><br> Os <br><br> Ba <br><br> Bi
    14·2 answers
  • Select all of the BENEFITS of a PARALLEL circuit. If one bulb burns out the rest of the bulbs will stay lit. The bulbs do not ge
    5·1 answer
  • The diagram below represents a beaker of water being heated by a flame. The arrows represent heat
    14·1 answer
  • A brick measures 0.018 dam by 6.5 cm by 17.3 cm. What is the volume of the brick in cubic centimeters
    6·1 answer
  • the latest weather report includes the following statement: the temperature is 78°f, barometric pressure is 29 and the relative
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!