1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Simora [160]
3 years ago
9

What are the monomers of a macromolecule

Biology
1 answer:
skad [1K]3 years ago
6 0
It depends on which macromolecule you are referring to. As examples:

Protein monomers are amino acids.
DNA monomers are nucleotides.
Carbohydrate monomers are monosacharides.
Lipid monomers are fatty acids and glycerol.
You might be interested in
________ are the largest lipoproteins, ranging in diameter up to 0.5 μm, produced by intestinal epithelial cells from the fats i
Temka [501]
<span>Chylomicrons are the largest.  Hope this helps.</span>
7 0
3 years ago
Why does weather vary from day to day?
sesenic [268]

Answer:

A

Explanation:

D is not correct because the atmosphere doesn't expand, C isn't correct because the Sun doesn't heat all the Earth evenly (hence different climates), B is not correct because cold fronts can be singular, so it has to be A

8 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Enumerati caracteristicile care fac din Rezervatia Delta Dunarii un unicat ecologic.
katrin [286]

1. Are peste 300 de specii de pasari

2.Este singura rezervatie naturala unde traieste cainele enot

3. Sunt specii de pesti care depun icre negre


5 0
3 years ago
Johanna took her little brother to the playgrond because he likes to swing
Dafna11 [192]

Answer:

the boy is in Kinetic energy

Explanation:

Because when he swings he isn't experiencing any forces towards him only the swing experiences potential energy

5 0
3 years ago
Other questions:
  • PLEASE HELP DUE IN 30MINUTES 
    5·2 answers
  • True or false see attachment.
    13·1 answer
  • Each label lists a specific joint type. determine the functional classification for each joint, then drag the label to the appro
    12·1 answer
  • PLEASE ANSWER QUICKLY
    8·1 answer
  • You should dedicate _______ of your dinner plate to protein-rich foods.
    5·2 answers
  • What is the name of the place a goat lives?<br>Think hard though one?​
    7·2 answers
  • After plates have been pushed upward by convection currents, gravity pulls them
    9·2 answers
  • Which is the best description
    13·1 answer
  • Explain how energy is released from ATP -
    6·1 answer
  • Living things are made of 4 types of large molecules called fats, proteins, sugars, and vitamins.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!