1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kisachek [45]
3 years ago
7

A molecular clock uses mutation rates in DNA to estimate the time that two species have

Biology
1 answer:
madam [21]3 years ago
5 0
D. Evolving independently
You might be interested in
Which event is associated with convergent boundaries?
baherus [9]

Answer:

I think it might be B

PLS TELL ME IF I'M WRONG!

4 0
3 years ago
Read 2 more answers
In a family of four children, all four children have blond hair and blue eyes. Which statement best explains why all four childr
sweet-ann [11.9K]
I think its B if I'm not correct I'm sorry
And get a A+ on the assessment :D
4 0
2 years ago
Read 2 more answers
Scientists can determine the age of a layer of rock by...?
Alexxandr [17]

Answer:

B) Identifying the minerals within it

Explanation:

Geologists commonly use radiometric dating methods, based on the natural radioactive decay of certain elements such as potassium and carbon, as reliable clocks to date the age of rock layers.

4 0
3 years ago
Which of the following would occur without gravity?
rosijanka [135]

Answer: humans would become weightless, we would be flying super fast across the earth; much like tumbleweeds.

Explanation:

because thats how gravity works.

5 0
3 years ago
Why doesn't the North Pole have frost action?
sergij07 [2.7K]
There's no land at the North Pole Instead it's all ice that's floating on top of the Arctic Ocean. ... Multi-year ice is thicker and has survived at least one melt season, whereas first-year ice is much thinner. Arctic sea ice usually reaches its minimum around mid-September each year.
5 0
3 years ago
Other questions:
  • PLEASE HELP QUICK??????
    5·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • A decrease in the oxygen-carrying ability of the blood, for any reason, is a condition known as ________.
    5·1 answer
  • A hernia in the groin area is called a/an
    10·1 answer
  • An environmental scientist studies _______.
    6·1 answer
  • What are three herbivores and carnivores in finding nemo
    7·2 answers
  • What four tissues is skin made of
    7·2 answers
  • A client with pneumonia develops respiratory failure and has a partial pressure of arterial oxygen of 55 mm Hg. The client is pl
    9·1 answer
  • What is the oxidation number of the polyatomic ion?​
    13·1 answer
  • Where in the cell does the krebs cycle part of cellular respiration occur ?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!