1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sammy [17]
3 years ago
12

In the twentieth century, where did the most ecologically destructive oil spill in the U.S. occur?

Biology
2 answers:
Nimfa-mama [501]3 years ago
6 0

Prince William Sound is the answer.

grin007 [14]3 years ago
3 0
Your answer is Prince William Sound

Gradpoint? Novanet?

Insta: 6abiface
You might be interested in
Define the term fossil, and name three different kinds of fossils.
abruzzese [7]
The remains or impression of a prehistoric organism preserved in petrified form or as a mold or cast in rock.

Mold fossils
Cast fossils
Trace fossils
4 0
3 years ago
Read 2 more answers
Every kind of rock can be changed into every other kind of rock.true or false
3241004551 [841]

Answer:

True

Explanation:

4 0
2 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
15. What would happen if the genes involved in differentiation were
Svetach [21]
The answer is A I think
8 0
2 years ago
What does a thermos do
zhannawk [14.2K]

Answer:

The answer is C. A thermos slows heat transfer.

6 0
3 years ago
Read 2 more answers
Other questions:
  • DNA can be found in all cells EXCEPT which of the following?
    15·1 answer
  • (SCIENCE)
    5·2 answers
  • Explain why Aristotle's system of classifying animals is no longer used by biologists?
    6·1 answer
  • What about science is importnat to us?
    13·2 answers
  • A(n) _____ is a cell that specializes in receiving and transmitting information
    12·1 answer
  • What does TEN sleep mean?
    14·1 answer
  • Which of these is not an environmental effect of destroying wetlands?
    5·2 answers
  • Which of the compounds below has a chemical formula of C4H10?
    12·1 answer
  • ⚠️Which statement below best describes cell respiration in the mitochondria?⚠️
    15·1 answer
  • What is is the attraction of water molecule to each other
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!