1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
larisa86 [58]
2 years ago
5

What are the benefits of using supercritical fluids in EGS​

Chemistry
1 answer:
Kaylis [27]2 years ago
8 0

Answer:

See detailed explanation.

Explanation:

Hello.

In this case, it is firstly necessary to cite that EGS accounts enhanced geothermal systems which are man-made reservoirs, placed where lots of  hot rock is present but there is lack natural permeability, which requires a fluid to be injected into the subsurface to re-open it and therefore creating permeability.

Typically, water has been used for this purpose, but due to the current issue on saving water alternative methods such as supercritical fluids has been being implemented because they have better dynamic properties such as lower viscosities and therefore larger flow velocities, supercritical CO2 is easy and cheap to get as low temperatures are required to turn it in supercritical condition.

Best regards.!

You might be interested in
Name two compounds in unpolluted air?
goblinko [34]
Nitrogen and oxygen are in unpolluted air

6 0
3 years ago
An neutral atom has 40 protons and 10 neutrons what is the mass number
olya-2409 [2.1K]

Answer:

50

Explanation:

40-10 = 30…...…............

5 0
3 years ago
Read 2 more answers
Given that nitrogen forms three bonds with hydrogen to make <img src="https://tex.z-dn.net/?f=NH_%7B3%7D" id="TexFormula1" title
lbvjy [14]

Answer:

Three hydrogen atoms to form PH₃.

Explanation:

Hello!

In this case, since the elements belonging to the nitrogen family (N, P, As, Sb and Bi) show five valence electrons, because there are five electrons at their outer shell, it is clear that if phosphorous bonds with hydrogen, it is going to require the same amount of oxygen atoms (3) because elements having five valence electrons need 3 bonds in order to attain the octet (5+3=8).

Therefore the compound would be:

PH_3

Which is phosphine.

Best regards!

3 0
2 years ago
The proteins of all living things require<br> geometry of amino acids.
Dmitry [639]

As the building blocks of proteins , amino acids are linked to almost every life process, but they also have key roles as precursor compounds in many physiological processes.

8 0
3 years ago
Read 2 more answers
How many molecules are in 34.7 grams of water?
Anika [276]

Answer:

This part require data such as Avogadro's number and the molar mass of water. But first, let's find the mass of water in the specified volume by making use of the density formula:

Density = mass/volume

1 g/mL = Mass/70 mL

Mass = 70 g

Each water contains 18 grams per mole, and each mole contains 6.022×10²³ molecules of water. Thus,

70 g * 1mole/18 g * 6.022×10²³ molecules/mole = 2.342×10²⁴ molecules of water

Explanation:

8 0
2 years ago
Other questions:
  • The density of concentrated ammonia, which is 28.0% w/w nh3, is 0.899 g/ml. what volume of this reagent should be diluted to 1.0
    7·1 answer
  • Acids, when mixed with water, do which of the following... A Taking away protons from the water molecules B Giving away protons
    13·1 answer
  • What are the components of black powder? What are the ratios of these components?
    9·1 answer
  • A large amount of dust and ash from a recent volcanic eruption settles in the region, which is most likely to survive, deer, fis
    10·1 answer
  • If a mineral with a density of 6 g/cm3 is broken into 3, what is the density of each new piece?
    12·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What are the three types of nuclear particles emitted when a radioactive atom decay?
    9·2 answers
  • Systematic error is defined as:_______.
    14·1 answer
  • Two amino acids frequently found in reverse turns are a. glycine and proline b. tyrosine and tryptophan c. leucine and isoleucin
    10·2 answers
  • Please help me with this science question!! 20 points ​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!