1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gogolik [260]
3 years ago
12

Definition: This organelle serves to process and package lipids and proteins in the cell. Term:

Biology
1 answer:
Oxana [17]3 years ago
5 0

I believe the term your looking for is the Golgi Body

You might be interested in
Show the genotypes of two individuals who
irga5000 [103]

It is considered that the child's IQ will be 50% more than parents IQ.

<h3>let's take an example</h3>

If parent's IQ is 100

50% of 100 is 50

Now add these values

100+50=150

So, The child's IQ will be always higher than parents.

4 0
3 years ago
Read 2 more answers
What is a protein that is the main component of the thick filaments in muscle fibers and is responsible for muscle contraction?
STatiana [176]

Answer:

Myosin

Explanation:

Two of the important proteins are myosin, which forms the thick filament, and actin, which forms the thin filament. Myosin has a long, fibrous tail and a globular head, which binds to actin. The myosin head also binds to ATP, which is the source of energy for muscle movement

4 0
3 years ago
A scientist who studies the variety of animals in the environment
Alenkinab [10]

Answer:

Zoologist

Explanation:

A person who specializes in the study of animals is called a zoologist. Zoologists who study certain kinds of animals have their own names.A botanist is a scientist who studies or experiments with plants. These plants may include a range of organisms, including flowers, trees and algae. Botanists are a type of biologist. Botanists study all forms of plant life.

6 0
3 years ago
During what period of life does skeletal mass increase dramatically
Svetradugi [14.3K]
Skeletal mass increases dramatically during childhood and adolescence, and decreases dramatically at the beginning of the fourth decade of life and decreases with age, with an exception of the skull.

Hope this helps! Have a BLESSED day! :-)
7 0
3 years ago
Meiosis is called reduction division because
den301095 [7]
Kore ha requiem da plus
am da baby
4 0
3 years ago
Other questions:
  • All anterior pituitary hormones except growth hormone affect their target cells via a cyclic amp second-messenger system.
    14·1 answer
  • What is it called when bacteria take in DNA from their environment?
    11·2 answers
  • The Miller-Urey experiment was designed to simulate the conditions on Earth before the evolution of life. They placed ammonia, w
    15·2 answers
  • Which of the following correctly lists functions of proteins? transporting substances, creating proteins, and fighting disease b
    6·2 answers
  • What helps regulate movement of substances through a cell's membrane?
    6·1 answer
  • How is atmospheric nitrogen converted into a biologically useful form of nitrogen?
    12·1 answer
  • Name the type of cell division that takes place in the zygote of an organism exhibiting haplontic life cycle​
    15·2 answers
  • Air gets warm from touching the land through _________. (4 points)
    9·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • How do solar radiation effect the climate
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!