1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lana71 [14]
3 years ago
15

What are 5 potential jobs that a students of astrology can obtain?

Biology
1 answer:
Marrrta [24]3 years ago
5 0
Acoustic emissions technician.
Acoustical physics.
Aerospace engineer
Air traffic controller
Ariel survey flight supervisor.
Artificial intelligence developer.
Assistant research officer.
Astronomer
You might be interested in
8-4 Discounting the Transverse Carrier Model. At one time, membrane biologists thought that transport proteins might act by bind
Natasha_Volkova [10]

Answer:

The two main reasons are nonpolar core of the bilayer and the active transport.

Explanation:

The membrane is structured to have two outer layers that are polar and an inner layer that is nonpolar.

If a membrane protein is exposed to the solvent, i<em>t will also have a polar side. It would be very difficult for the polar face of the membrane to move through the nonpolar core of the bilayer.</em> Therefore, this model is not feasible.

One major form of transport, active transport, moves solutes up the concentration gradient. <em>The binding of a solute and then release on another side of the membrane would only work for facilitated diffusion because it would cause a net movement of solutes down the concentration gradient.</em> It is unclear how energy could be expended to drive this process in the transverse carrier model.<em> Therefore, the transverse carrier model does not explain active transport.</em>

6 0
3 years ago
One of a group of external regulatory proteins that stimulates the growth and division of cells is
Schach [20]

Answer:

Cyclin-regulates the timing of the cell cycle. Normally, when cells touch, they stop growing. Growth factors-one of a group of external regulatory proteins that stimulate the growth and division of cells.

Explanation:

I hope it's help u

4 0
3 years ago
How many million years ago did the supercontinent Pangaea form
igor_vitrenko [27]

Answer:

335 million years ago

Explanation:

Pangaea or Pangea ( /pænˈdʒiːə/) was a supercontinent that existed during the late Paleozoic and early Mesozoic eras. It assembled from earlier continental units approximately 335 million years ago, and began to break apart about 175 million years ago.

8 0
3 years ago
If the "free" water molecule concentration outside of a cell is higher than that inside the cell, the solution outside of the ce
lubasha [3.4K]
... termed "hypotonic," meaning less solids (or more diluted) than inside the cell. For fluid movement in/out of cells, water will diffuse (via osmosis) from the hypotonic solution to the hypertonic one, assuming a permeable barrier (i.e. cell membrane) allows it. With this case, water will flow into the cell from outside.
7 0
3 years ago
What are some factors that can increase or decrease the heart rate and the beat you feel at each pulse point?
Amanda [17]
One factor is resting and exercising
stress and peace
4 0
3 years ago
Other questions:
  • Which best describes an acquired trait? A.An acquired trait is encoded in the DNA.
    10·2 answers
  • Example of ecosystem?
    6·2 answers
  • Identify the plant organs seen in the drawing.
    7·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • In glycolysis, each molecule of glucose is broken down into two molecules of pyruvate. when this happens, most of the potential
    8·1 answer
  • Question 5
    12·1 answer
  • What would happen if sister chromatids did not line up correctly during metaphase
    9·1 answer
  • Match each type of cell junction with its description.
    9·1 answer
  • Role of T helper cells in the specific immune response
    12·2 answers
  • What is the law of conservation of energy?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!