1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semenov [28]
4 years ago
11

Which process copies instructions from dna onto mrna​

Biology
1 answer:
OlgaM077 [116]4 years ago
7 0

Answer:

Transcription is the process through which DNA is copied into mRNA

Explanation:

The transcription is the process that copies the DNA  in to mRNA. It is also referred as the initial step in the dual step process for protein synthesis, which happens inside the nucleus of the cell.  After transcription, the translation step happens. In this step i.e. transcription, the genetic materials are transferred to the mRNA. mRNA strand made is exactly similar to that of strand of DNA in transcription as the DNA requires a base strand for sequence.

You might be interested in
How does water effect metamorphic process
EleoNora [17]

Answer: The role of water in metamorphism is determined by the independent variables rock pressure, temperature, water pressure, and the amount of water present.

Explanation:

5 0
3 years ago
Read 2 more answers
3 Peroxisomes are cellular organelles: A. with their own genome B. present only in protists C. without membrane OR D. collaborat
VLD [36.1K]

Answer:

E.site of some oxidation reactions

7 0
3 years ago
Based on these concepts, choose statements that correlate Mendel's four postulates with what is now known about genes, alleles,
Vikentia [17]

Answer:

Explanation:

Mendel four postulate is Principles of Paired Factors, Principle of Dominance, Law of Segregation which is Mendels First Law of Inheritance and Law of Independent Assortment which is Mendel’s Second Law of Inheritance.

The six possible outcome are,

3. Alleles segregate from each other during gamete formation at anaphase I gene assorts independent of each other during gametes formation.

4. Some genes have dominant and recessive alleles. Allele of a gene can either be dominant or recessive in its form

7. Unit factors occur in pairs , allele of a gene occur in pair

Dominant alleles can become codominant alleles during mitosis, when two allele both finds expression in the phenotype of an organism they are codominant

8. One gene pair separates independently from other gene pairs independent assessment of gene.

5. Different gene pairs on nonhomologous chromosomes will separate independently from each other during meiosis.

5 0
3 years ago
NEED HELP ASAP WILL GIVE BRAINILIEST THANK YOU
Grace [21]

TCTCG and AGAGC are the perfect pair.

Option A

<h3><u>Explanation:</u></h3>

DNA is the genetic molecule of a living cell. The DNA stores genetic information of the species inside itself by means of particular pattern or sequence of nitrogen bases called as gene. The gene is comprised of the particular sequence of nitrogenous bases which are four in number - adenine, guanine, thymine and cytosine.

The nitrogen bases are present in both the strands of DNA and they have complementary relationship between them. The adenine forms hydrogen bonds with thymine and guanine pairs with cytosine.

Here the sequence of one strand is given as TCTCG. So according to the complementary pairing process, the opposite strand must have the sequence of AGAGC to maintain the structure.

4 0
3 years ago
Define "animal cell" in about 1 sentence.
IgorLugansk [536]
A cell which contains cytoplasm, cell membrane and a nucleus
7 0
4 years ago
Read 2 more answers
Other questions:
  • Blank is producing plants for beauty
    13·1 answer
  • What name is given to fossils that are widespread geographically, are abundant in number, and are limited to a short span of tim
    13·1 answer
  • What is always forbidden in the lab
    13·2 answers
  • What types of flowers produce the most nectar?
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • During prophase dna condenses into x-shaped structures called
    14·1 answer
  • Why is meiosis called reduction division? *
    5·1 answer
  • Compared to asexual reproduction, the main advantage of sexual reproduction is that it
    8·1 answer
  • Can carbon atoms bond with other atoms to form long chains?
    11·2 answers
  • A soil associated with the hot and wet tropics is _____.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!