1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oduvanchick [21]
3 years ago
6

Who criticized Marx for focusing exclusively on economics and social class as explanations for human behavior and advocated soci

ological analyses that allowed for multiple influences, including ideas and beliefs of people?
Biology
1 answer:
GaryK [48]3 years ago
6 0

Answer:

The answer is Max Weber.

Explanation:

Max Weber assumed that society and the problems of governments were dominant consequences in society, and the enhancement of balance was transformed into an establishment in sociology. In society, culture, ideas, religion, etc., they contribute to the prosperity of the social order. The subjective for Max Weber became the interpretative in human science.

You might be interested in
Which three statements correctly describe the endoplasmic reticulum?
Sunny_sXe [5.5K]

I have searched everywhere, but I have not found the proposals of the question, but I will explain to you what is the endoplasmic reticulum so that you can answer it.

The endoplasmic reticulum is a eukaryotic organelle located in the cytoplasm.

The endoplasmic reticulum is a network of membrane tubules (often interconnected) scattered throughout the cytoplasm of eukaryotic cells. Its membrane, which alone represents more than half of the cellular membrane system, is in contact with the nuclear envelope.

The endoplasmic reticulum can be:

Granular (or rough) (RER) that is to say associated with ribosomes.

Smooth (SER).

The granular endoplasmic reticulum is the place of synthesis (in the associated ribosomes) of the proteins secreted outside the cell and of the proteins and lipids constituting the membranes of the cellular organelles. Golgi, lysosomes, mitochondria, nucleus, ribosomes, vesicles ...). It participates in the correct folding of the proteins that have just been synthesized.

The smooth endoplasmic reticulum participates in cellular metabolism, synthesizing lipids and storing calcium.

5 0
3 years ago
I need help
Mnenie [13.5K]

Answer:

A. Sediment

Explanation:

As water flows, it both breaks down rocks and picks up soil. When the pieces of rock and soil are travelling in water, they are called sediment.

3 0
3 years ago
Read 2 more answers
What are 3 to 4 characteristics that make animals different from other organisms such as plants?
Darina [25.2K]
Gbsbabfaefbaebaerbgaergaergaergaer

4 0
3 years ago
What's the answer please?
Sphinxa [80]

Answer:

C

Explanation:

8 0
3 years ago
Read 2 more answers
Which of these cells does not have a nucleus?
Fudgin [204]

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

                  Hello!

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

❖ The correct answer choice is B. prokaryote.

~ ʜᴏᴘᴇ ᴛʜɪꜱ ʜᴇʟᴘꜱ! :) ♡

~ ᴄʟᴏᴜᴛᴀɴꜱᴡᴇʀꜱ

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which two organisms are most closely related, based on the tree above?
    13·1 answer
  • Give three examples of places bacteria live.
    6·2 answers
  • __ destroy billions of dollars of food crops worldwide annually
    12·1 answer
  • What is the best definition for hypothesis?
    5·2 answers
  • What is the climate zone around the equator that extends from approximately 23.5 degrees north latitude to 23.5 degrees south la
    14·2 answers
  • A 79 year-old male resident of a long term care facility has contracted clostridium difficile and is experiencing consequent dia
    13·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Two 9×13 rectangles overlap to form a 9×22 rectangle. What is the area of the overlap region?
    12·1 answer
  • A standard drink contains __________ of alcohol.
    11·1 answer
  • please needed as soon as possible thank you!
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!