1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nata [24]
3 years ago
11

14 Points!!!! WILL MARK BRAINLIEST!!!!

Biology
1 answer:
ehidna [41]3 years ago
3 0
I believe the answer is:
Geosphere and hydrosphere

Biosphere and atmosphere

Hydrosphere and biosphere

Atmosphere and geosphere

Hopes this helps! ^_^
You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
What statement correctly describes the relationship among endocrine glands, target cells, water-soluble hormones, and lipid-solu
9966 [12]

Water-soluble and lipid-soluble hormones that bind to target cells are secreted by endocrine glands.

The interaction between endocrine glands, target cells, water-soluble hormones, and lipid-soluble hormones is accurately described by the aforementioned sentence.

<h3>What functions and how does the endocrine system operate?</h3>

The level of hormones in your blood is regularly monitored by your endocrine system. In order to transmit the message, hormones send their messages by locking into the cells they intend to reach.

When your hormone levels increase, the pituitary gland signals other glands to stop manufacturing and releasing hormones. The pituitary gland has the ability to tell other glands to manufacture and release additional hormone when levels fall below a certain threshold.

Homeostasis is a process that functions similarly to your home's thermostat. Almost every physiological process is impacted by hormones, including:

  • Metabolism
  • Growth & development.
  • Emotions & mood.
  • Fertility & sexual function.
  • Sleep.
  • Blood pressure.

Learn more about hormones

brainly.com/question/9641905

#SPJ4

6 0
1 year ago
Go to bad jk hey wyd
Tresset [83]

Answer:

Can someone pls answer my questions plssss?

Explanation:

4 0
3 years ago
Read 2 more answers
How can speciation of plants benefit humans?
umka2103 [35]
brainly.com/question/1333545 Hope this helps!
4 0
3 years ago
Read 2 more answers
A pond near a city park is found to be contaminated with both bacteria and excess nitrogen. The bacteria most likely came from _
kiruha [24]
<span>Excess nitrogen is brought in the pond from the fertilizer, which are ladden in nitrogen and phosphorous, and rain water or running water takes that nitrogen to the water bodies.Bacteria must have come from the sewage disposal in the pond. Sewage is rich in organic material and allows proliferation of bacteria, which is taken to the pond when the sewage is disposed in the pond.</span><span />
6 0
3 years ago
Other questions:
  • The process of active transport requires the most use of
    8·2 answers
  • While assessing an older adult during a regular health checkup, a nurse finds signs of elder abuse. which physical findings woul
    15·1 answer
  • Nina is learning about plants in school. Her teacher gives her group a stack of cards that list things that plants might need to
    14·2 answers
  • I need help w these two
    7·1 answer
  • Determine whether the statements about DNA are
    14·2 answers
  • Which observation would most likely be made before an experiment?
    14·2 answers
  • explain how darwin's observations of finches in the galapagos islands supply evidence for the theory of natural selection?
    13·1 answer
  • Some coastal regions of the world have cooler summers and warmer winters than inland regions at the same latitude. What accounts
    9·2 answers
  • What must reptiles do if their body temperature gets too low?
    7·1 answer
  • What adaptations de only bears have that make them able to survive in their ecosystem?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!