1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
3 years ago
5

What kind of cells can secrete substances at the epithelial surface?​

Biology
1 answer:
kogti [31]3 years ago
5 0

Answer:

Epithelial cells

Explanation:

Epithelial cells are cells that secret mucus to prevent friction between organs. Like between the Heart and Lung.

You might be interested in
Aero in aerobic and anaerobic respiration stands for?
AleksAgata [21]
Aero is the prefix for oxygen or air
Aerobic= needs air
Anaerobic=no air needed
4 0
2 years ago
What part of the fibula is found near the knee joint?
kkurt [141]
The part of the fibula that is found near the Knee joint is the head
6 0
3 years ago
Why do deciduous trees lose their leaves? a. Deciduous trees lose their leaves to prevent oxygen loss. b. Deciduous trees lose t
Alika [10]
The answer to your question is a 
8 0
3 years ago
Read 2 more answers
Which set of data would be best illustrated with a bar graph
hichkok12 [17]
Colors and the number of people that like them.
5 0
3 years ago
Read 2 more answers
Explain the process of mitosis in a tissue culture<br> for normal cells.<br> DONE
Lina20 [59]
During mitosis, a eukaryotic cell undergoes a carefully coordinated nuclear division that results in the formation of two genetically identical daughter cells. ... Cancer cells are taken from a living organism and grown in a culture. Cancer cells grow at an uncontrolled rate.
6 0
3 years ago
Other questions:
  • A _____________ is a grouping of outcomes in which the order does not matter.
    9·1 answer
  • Which type of rock is non-foliated metamorphic rock?
    11·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Why is uva light considered mutagen?
    7·1 answer
  • You driving your vehicle on a municipal street and are approaching a school crosswalk
    7·1 answer
  • What is the difference between compisition and texture
    13·2 answers
  • A bird’s ability to fly south when winter weather approaches is an example of a what adaptation?
    13·2 answers
  • Two processes are described below:
    7·2 answers
  • Summarize: In your own words, describe what heredity is and how it works in mice.
    5·1 answer
  • ¿Qué importancia tiene el saber sobre las propiedades de la energía?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!