1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NARA [144]
3 years ago
9

Insulin A) is released during fasting periods, such as between meals. B) increases blood glucose levels after meals. C) stimulat

es cells to break down glycogen for energy. D) helps glucose enter cells.
Biology
1 answer:
givi [52]3 years ago
3 0

Answer:

The correct answer is D) helps glucose enter cells.

Explanation:

Insulin is a hormone that is released by the beta cells of the pancreas. It is released when the glucose level in the blood gets increase from its normal level.  

Insulin helps in reducing the blood glucose level by making the blood glucose to enter the cells so that the blood sugar level gets to normal level and cells can get energy. Insulin also helps in storing glucose in the form of glycogen in the liver and muscles. Glucagon is the hormone that works antagonistic to insulin.

You might be interested in
stem cells of plants have an unusual tubular structure unlike most other types of plant cells. What function of plant stem cells
Bad White [126]
Hey You!

The function of plant stem cells that is related to their shape and structure is: D) Transport.
4 0
3 years ago
Read 2 more answers
What are the components of adenosine triphosphate (ATP)?
Liula [17]

Answer:

base, sugar and three phosphates

3 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
For 50 points and brainliest. Please help!
hram777 [196]

Answer:

Give me brainliest and ill make a question for 50 points

Explanation:

7 0
2 years ago
Read 2 more answers
Which of the following terms is/are associated with the body’s capacity to produce ATP aerobically
Sav [38]
Oxygen consumptionIs your answer
4 0
3 years ago
Other questions:
  • In the 17th century many people in scientist believe spontaneous generation of life occurred what is spontaneous generation and
    13·1 answer
  • Discuss how the idea of vertical farming reflects the role of science in society.
    5·1 answer
  • Which statement is true about a solution that has a pH of 3? A. It is abnormal. B. It is acidic. C. It is alkaline. D. It is neu
    6·2 answers
  • Ignore this thx sjshgfkskwka
    10·1 answer
  • What characterizes a cold glacier?
    7·2 answers
  • 1. Which of the following structures in the diagram below enables the observer to identify that it is a plant cell? a. 1 and 3 b
    14·1 answer
  • Choose the object that would provide the best greenhouse effect.
    9·1 answer
  • Both plants and animals have these organelles to store and pass on genetic information
    10·1 answer
  • What can genetics be defined as
    11·1 answer
  • Which of the following shows the levels of organization in correct order from simplest to most complex?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!