1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sweet-ann [11.9K]
3 years ago
8

If the climate in Africa stays the same what would you expect to see in a snake head fish it has grown legs or uses fins to walk

Biology
2 answers:
jeyben [28]3 years ago
8 0
Usually the snake head fish would adapt to the climate in Africa or dry out because it doesn't meet the needs of a fish.
algol [13]3 years ago
4 0
Uses fins to walk , because they would have to adapt and evolve
You might be interested in
Why body system is dependent on a constant supply of iron, and what deficiency is caused when this mineral is lacking?
KATRIN_1 [288]
The respiratory system always needs iron. The red blood cells are in charge of the transport of O2. They need iron to do this. 

Hope this helps! :)
7 0
3 years ago
Read 2 more answers
The two sides of the DNA ladder are connected down the middle by many _______ bonds. *
daser333 [38]

Answer:

non-covalent hydrogen bonding between paired bases :)

Explanation:

have a wonderful weekend stay safe!

4 0
3 years ago
Read 2 more answers
What is cotransport? Explain how understanding it is used in our treatment of diarrhea.​
qaws [65]

Answer:

In cotransport, a single ATP-powered pump that transports a specific solute drives the active transport of several other  solutes. Normally, sodium in waste is reabsorbed in the colon, maintaining constant levels in the body, but diarrhea  expels waste so rapidly that re-absorption is not possible, and sodium levels fall precipitously. To treat this life threatening condition, patients are given a solution to drink containing high concentrations of salt and glucose. The  solutes are taken up by sodium-glucose cotransporters on the surface of intestinal cells and passed through the cells into  the blood. This simple treatment has lowered infant mortality worldwide.

6 0
4 years ago
Which term means blue discoloration of the skin caused by a lack of adequate oxygen?
vitfil [10]
The term for blue skin caused by lack of oxygen is cyanosis. One is said to be cyanotic when presenting with this discoloration.
7 0
4 years ago
________ is not required for anaerobic respiration.
Aleks04 [339]
Oxygen is the correct answer !
8 0
3 years ago
Other questions:
  • How do ultrasound waves clean jewellery
    12·2 answers
  • What if humans could reproduce through mitosis instead of using meiosis? What would children look like if parents reproduced usi
    8·1 answer
  • How many planet in evil eye galaxy
    14·2 answers
  • A patient is going through chemotherapy and has started to suffer from anemia. What body part listed below is being affected?
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • A hydrocarbon of pentane has two isomeric forms—n-pentane and iso-pentane. The molecular formula of the n-pentane is C5H12. Pred
    10·1 answer
  • Which statement best describes the relationship of photosynthesis and energy?​
    9·2 answers
  • the food substance which when tested with iodine solution turns blue-black is A . protein B. oil C.vitamin D. starch ​
    8·2 answers
  • PLEASE HURRY!!! What are some negative impacts of genetically modified foods
    5·2 answers
  • 3. Describe What are two functions of the fluids in semen?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!