1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Burka [1]
2 years ago
12

Where in the cell does the krebs cycle part of cellular respiration occur ?

Biology
1 answer:
neonofarm [45]2 years ago
8 0

Answer:

<u>In the mitochondrial matrix</u>

<u></u>

Explanation:

The mitochondria is an organelle within the cytoplasm of the cell.  It consists of an outer membrane, inner membrane, and matrix containing a gel-like substance. During aerobic respiration in mitochondria, cells break down sugars in the form of glucose into CO_{2} (carbon dioxide) and  H_{2} O (water) to obtain energy in the form of ATP or adenosine triphosphate.

aerobic respiration:

C6H12O6+ 6 O2        →      6 CO2 + 6 H2O + ≅38 ATP

(glucose)   (oxygen)         (carbon dioxide) + (water)

The Kreb's cycle involves several enzymatic reactions, where pyruvate derivatives obtained from glycolysis, are reduced and oxidized to harvest energy as ATP.

You might be interested in
A gene that when mutated leads to organisms with structures in abnormal places is termed select one:
zvonat [6]
Homeotic genes regulate the development of structures. Logically, then, the mutation of this gene must result in improper structure development, such as structures in abnormal places. The answer is C.
3 0
2 years ago
Read 2 more answers
How can scientists use DNA in crime scene investigations? (1 point) They analyze the size of the DNA to determine where a crime
hammer [34]
They analyze the sequence of bases in the DNA to determine who committed a crime.
8 0
3 years ago
Read 2 more answers
Which type of molecule acts as a signaling molecule in yeasts?
zhuklara [117]

Answer:

The correct answer is the option - mating factor.

Explanation:

Yeast can reproduce sexually by a signaling pathway called the mating factor pathway. Mating in yeast occurs between two haploid yeast cells. In this process, two yeast cells form a diploid cell.

In this process yeast cells secrete a signaling molecule termed as the mating factor that is used to attract them to mating cells to form a diploid cell.

Thus, the correct answer is option - mating factor.

5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
(GIVING BRAINLIEST!!)
andrey2020 [161]

Answer:

Hurricanes are large, swirling storms. They produce winds of 119 kilometers per hour (74 mph) or higher. That's faster than a cheetah, the fastest animal on land. Winds from a hurricane can damage buildings and trees.

tornado is a violent rotating column of air extending from a thunderstorm to the ground. The most violent tornadoes are capable of tremendous destruction with wind speeds of up to 300 mph. They can destroy large buildings, uproot trees and hurl vehicles hundreds of yards. They can also drive straw into trees.

Earthquake is a term used to describe both sudden slip on a fault, and the resulting ground shaking and radiated seismic energy caused by the slip, or by volcanic or magmatic activity, or other sudden stress changes in the earth.

A flood is an overflow of water that submerges land that is usually dry. In the sense of "flowing water", the word may also be applied to the inflow of the tide. Floods are an area of study of the discipline hydrology and are of significant concern in agriculture, civil engineering and public health.

Wildfires are fires that burn out of control in a natural area, like a forest, grassland, or prairie. They often begin unnoticed. They spread quickly, and can damage natural resources, destroy homes, and threaten the safety of the public and firefighters. Humans cause most wildfires.

7 0
2 years ago
Read 2 more answers
Other questions:
  • Spreading centers with high spreading rates, such as those where plates are diverging rapidly, are characterized by a long, gent
    13·1 answer
  • List the differenced between mitosis and meiosis
    10·1 answer
  • 3. Which plant organelle carries out photosynthesis and produces the gas?
    10·1 answer
  • Are pennies polar or non-polar?
    9·2 answers
  • What are the respiration organs of the following fishes mamals insect lizzard​
    11·1 answer
  • Blood should not be stored in what way?
    14·1 answer
  • How does the lithosphere support life
    13·1 answer
  • How do different organisms affect enzyme rates
    14·1 answer
  • What is the fuction of the spindle fibers
    15·1 answer
  • True or False: The cells produced by the cell cycle are identical to each other.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!