1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nydimaria [60]
3 years ago
7

Explain how fertilization occurs

Biology
1 answer:
alex41 [277]3 years ago
5 0
<span>I'm assuming this in plants.

Brief-ish answer:

"Fertilization in plants occurs when pollen grains are transported from anthers to stigma. When ripe pollen from an anther catches on the stigma of the same kind of flower, each pollen grain sends out a small thread-like tube."

Here's a fuller answer:

"</span>Fertilization occurs after pollination, when pollen grains land on the stigma of a flower of the same species. During this time, a series of events take place leading to the formation of seeds. A pollen grain on the stigma develops a tiny tube that runs down the style of the ovary. The pollen tube contains a male gamete which meets the female gamete in the ovule. Fertilization occurs when the two gametes combine and their chromosomes join. The resulting product is a normal complement of chromosomes, with some from either parent flower. The fertilized ovule forms a seed, which consists of a food reservoir and an embryo that later develops into a new plant. In gymnosperms (conifers) male gametes are enclosed in pollen grains and are transmitted by wind or insects to the female reproductive organs. Fertilization in angiosperms (flowering plants) occurs when insects or other animals transport the pollen to the female reproductive organ (pistil).<span>
</span><span>Fertilization is the fusion of gametes to launch the development of a new individual organism. In animals, the process entails the combination of ovum with a sperm, leading to the development of an embryo. Fertilization in plants occurs when haploid gametes meet to create a diploid zygote, which eventually forms an embryo.</span><span>"

source: </span>https://www.reference.com/science/plant-fertilization-occur-ccf48c80e72fc410
You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
An example of carbon 3 plant is<br>A, Rice<br>B, Maize,<br>C, Millet<br>D, Barley​
Svetlanka [38]

Answer:

the correct answer is Rice

8 0
3 years ago
Read 2 more answers
the eyeless gene is required for eye formation in drosophila. it encodes a homeodomain. a. what would you predict about the bioc
Arte-miy333 [17]
<h3>Briefing:</h3>

In Drosophila, the eyeless gene is necessary for the development of eyes. Given that it encodes for a homeodomain, its protein may have a role as a transcription factor that binds DNA in a specific sequence. In situ hybridization can be used to study the gene's mRNA expression pattern, and immunological methods can be used to study the protein.

A. Since the eyeless gene in Drosophila encodes for a homeodomain, one potential use for its protein is as a DNA-binding transcription factor that binds to specific DNA sequences.

B. As implied by its function, the eyeless gene should be expressed in the Drosophila cells in charge of eye formation. In situ hybridization of the gene's mRNA expression is one potential test to find the gene. The protein can also be seen via a variety of immunological and staining methods. It is possible to do gene deletion experiments to see if Drosophila will retain its eyes or go blind. Additionally, genetic engineering can determine whether the eyeless gene expressed in other organs can result in the creation of eyes.

C. Transgenic tests can be used to determine whether the Small eye and Aniridia genes function similarly to the fly eyeless gene. Since both of these function as master switches for the genes that create eyes, it is possible to transfer the mouse Small eye gene into Drosophila to observe whether it is expressed. These, however, are simply Drosophila eyes and not comparable to mouse eyes.

<h3>Describe DNA:</h3>

All known organisms, including many viruses, require deoxyribonucleic acid, a polymer comprised of two polynucleotide chains that coil around one another to create a double helix, to develop, function, grow, and reproduce. DNA and ribonucleic acid are examples of nucleic acids.

To know more about DNA visit:

brainly.com/question/264225

#SPJ4

6 0
1 year ago
HELP ASAP!! DUE TOMORROW!! WILL MARK AS BRAINLIEST IF ANSWERED NOW!!
Dmitry [639]
1) B
    (I'm not so sure of this one) All of the other options have a steady impact on population regardless of the density of organisms except competition

2) D
    Increased carbon dioxide levels would not hinder plant growth, and tsunamis aren't really linked to carbon dioxide levels. Increased carbon dioxide is unlikely to lower the air temperature so only D is left.

3) A

4) Three properties of water that allow it to sustain life are that it is adhesive, it is a good solvent, and cohesion. Adhesion is important in situations such as water travelling up xylem tubes in plants so that the water is not pulled down by gravity and can reach parts of the plant that need water. Cohesion allows the water being pulled up the xylem to stay together and for water molecules to be pulled when a neighbouring one is moved. Water being a good solvent allows inorganic minerals to be taken with water through vascular tissue, such as in the previous example.
3 0
3 years ago
This is science could someone please do this for me and in return ill give you some points :D
Iteru [2.4K]
49483838495949438382828283939
4 0
2 years ago
Other questions:
  • Why are there seasons
    15·2 answers
  • This is formed as a waste product in photosynthesis and used as a reactant in respiration.
    14·1 answer
  • What do you think might be the evolutionary benefit of the milk production regulation mechanism in breastfeeding?
    5·2 answers
  • Please heeeeeelp
    7·1 answer
  • I have a large role in muscle developement
    13·1 answer
  • What was the main purpose of the declaration of independence
    11·1 answer
  • Is this a vascular plant or non vascular plant?
    8·2 answers
  • Which one of the following items would be best measured using meters?
    11·1 answer
  • How does food move through your digestive tract? Is it voluntary (do you control it) or involuntary? What is the process called?
    9·2 answers
  • PLSSS HELP IF YOU TURLY KNOW THISS
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!