All categories

2 years ago

Which best describes oogenesis and spermatogenesis?

2 answers:

5 0

The answer is B. In both oogenesis and spermatogenesis, the cells become haploid after meiosis I.

Gametogenesis is a process in which gametes are produced. Oogenesis is a process in which egg cells are produced and spermatogenesis is a process in which sperm cells are produced. Both processes include meiosis.
Original diploid cell (primary oocyte or spermatogonium) has 46 chromosomes. After meiosis I, there are two haploid cells. After meiosis II, there are 4 haploid cells because meiosis II is similar to mitosis. The difference between spermatogenesis and oogenesis is that those 4 cells after meiosis II in spermatogenesis are all sperm cells, and in oogenesis only one of them is egg cell.

Bess [88]2 years ago

3 0

Answer:

B. In both oogenesis and spermatogenesis, the cells become haploid after meiosis I.

Explanation:

i got it right

You might be interested in

What are two basic differences between DNA and RNA

Marrrta [24]

DNA is what codes for everything in your body and DNA helps make proteins mRNA tRNA and rRNA

8 0

2 years ago

Read 2 more answers

collagen is a protein found in connective tissue in animals and lysozyme is a protein that breaks down bacterial cell walls. Aft

Stells [14]

<h2>The Protein Structure</h2>

Explanation:

Protein structure is the three dimensional game plan of particles in an amino corrosive chain atom.
Proteins are polymers explicitly polypeptides framed from groupings of amino acids, the monomers of the polymer.By show, a chain under 30 amino acids is regularly distinguished as a peptide, rather than of a protein.
All proteins have primary, auxiliary and tertiary structures yet quaternary structures possibly emerge when a protein is comprised of at least two polypeptide chains.
The collapsing of proteins is additionally determined and fortified by the arrangement of numerous bonds between various pieces of the chain.
Connective tissues for the most part have barely any cells and extensive extracellular filaments including collagen and elastin.
Collagen is the absolute most abundant protein in the creature body and establishes roughly 25–35% of the entire body content.

6 0

2 years ago

What 4 thing do cells have? 1. 2. 3. 4. 2 basic types of cells 1. 2.

STALIN [3.7K]

The 4 things that both cells have is a plasma membrane, ribosomes, cytoplasm, and DNA!

the 2 basic types of cells are eukaryotic and prokaryotic.

(i had to go digging through my old science notes for this haha)

7 0

2 years ago

Read 2 more answers

If you were planting a vegetable garden, what should you consider for the time of planting?

zvonat [6]

When planting vegetables it is very important to know the climate of the area, its usual patterns, and how will that affect the growth and development of the crops. The soil quality too is very important, as it is the basis for the development of the root-stock of the crops.

If we have a temperate type of climate, than we have four different seasons, meaning different weather patterns throughout the year. We can take onions, radish, and peppers as vegetables of choice. The onions can be planted in mid-autumn, as they will need more moisture, and they are resilient to low temperatures, thus will not have problems in the winter, and in the spring they will already have the basis so will grow quickly and be larger. The radish can be planet in late winter or early spring, in a period when there is more precipitation. It is not a vegetable that likes high temperatures, so with its quick development, it will be able to develop the tuber by late spring. The peppers can not sustain low temperatures, so they should be planted in late spring. They also like warm weather and lot of water, so it will be needed to water them a lot in the hot and dry period. They will manage to develop and produce the vegetables by the end of the summer, thus not getting damaged by the cold nights in the autumn.

7 0

2 years ago

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a

frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0

2 years ago