Answer:
The correct answer is a) It brings a transport liquid into close contact with all cells in the body.
Explanation:
The circulatory system helps in bringing the blood which is a transport liquid in close contact with the cells present in our body. This helps in gas exchange between cells and blood. The circulation of blood in the body occurs by the pumping of blood by the heart into arteries, veins, and capillaries.
This circulation of blood plays many other vital functions like transport of nutrients to the cells, transport of waste products from the cell to outside the body, transport of hormones, maintenance of body temperature, etc.
So all these processes become possible when transport liquid comes in contact with the cells. Therefore the right answer is a.
Answer:c
Explanation: The plant is responding to external stimuli by growing toward light like our eyes adjusting to the light in the dark......................
Chromosome is a structure that contains DNA molecules packaged around histone proteins, therefore carries the heredity material. Chromosomes number determines whether a cell is haploid (n) or diploid (n). A diploid cell has both set of homologous chromosomes while the haploid cell has only one set. Nucleus is the cellular structure that is responsible for the localized storage of chromosomal DNA.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Its b) as the colder a substance is the more pwcked the moleciles are
